Gene Page:ABI1

Summary?
GeneID 10006
Symbol ABI1
Synonyms ABI-1|ABLBP4|E3B1|NAP1BP|SSH3BP|SSH3BP1
Description abl interactor 1
Reference MIM:603050|HGNC:HGNC:11320|Ensembl:ENSG00000136754|HPRD:04336|Vega:OTTHUMG00000017848
Gene type protein-coding
Map location 10p11.2
Pascal p-value 0.004
Fetal beta -0.74
eGene Myers' cis & trans
Meta
Support STRUCTURAL PLASTICITY
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
CompositeSet
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
简历:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2716734 chr2 39947720 ABI1 10006 1.834E-6 trans
rs2716736 chr2 39947946 ABI1 10006 1.834E-6 trans
rs6446391 chr4 5695478 ABI1 10006 0.17 trans
rs17023105 chr4 96074164 ABI1 10006 0.01 trans
rs10516959 chr4 96088848 ABI1 10006 0.11 trans
rs16869878 chr5 2523760 ABI1 10006 0.05 trans
rs467856 chr5 3128168 ABI1 10006 0.11 trans
snp_a-2169623 0 ABI1 10006 1.694E-5 trans
rs13175086 chr5 174691428 ABI1 10006 0.11 trans
rs17165806 chr7 93469599 ABI1 10006 0.05 trans
rs7777209 chr7 93485280 ABI1 10006 0.05 trans
snp_a-2308001 0 ABI1 10006 0.08 trans
rs870686 chr8 25253521 ABI1 10006 0.02 trans
rs10503771 chr8 25304019 ABI1 10006 0.02 trans
rs12255258 chr10 106306927 ABI1 10006 0.06 trans
rs11601862 chr11 76333269 ABI1 10006 0.2 trans
rs7298298 chr12 17810638 ABI1 10006 0.13 trans
rs2764585 chr13 46880234 ABI1 10006 0.19 trans
rs9590075 chr13 95414389 ABI1 10006 0.02 trans
rs1507047 chr16 50932778 ABI1 10006 0.18 trans
rs349973 chr17 50642288 ABI1 10006 0.01 trans
rs6128541 chr20 57917688 ABI1 10006 0.2 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0008092 cytoskeletal protein binding TAS 9593709
Biological process GO term Evidence Neuro keywords PubMed ID
去:0007169 跨膜受体蛋白酪氨酸的同胞ase signaling pathway TAS 9010225
GO:0008285 negative regulation of cell proliferation TAS 9010225
GO:0018108 peptidyl-tyrosine phosphorylation IDA 17101133
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0019717 synaptosome IEA Synap, Brain (GO term level: 7) -
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0005829 cytosol TAS 9010225
GO:0005856 cytoskeleton IEA -
GO:0005622 intracellular IDA 17101133
GO:0005625 soluble fraction TAS 9010225
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0005783 endoplasmic reticulum TAS 9593709
GO:0030027 lamellipodium IDA 17101133
GO:0030054 cell junction IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ABL1 ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl c-abl oncogene 1, receptor tyrosine kinase - HPRD 9010225|12672821
ABL1 ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl c-abl oncogene 1, receptor tyrosine kinase hNap1BP interacts with Abl. BIND 11418237
ABL1 ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl c-abl oncogene 1, receptor tyrosine kinase Affinity Capture-Western
Reconstituted Complex		 BioGRID 9010225|11418237
|12672821
DNM2 CMTDI1 | CMTDIB | DI-CMTB | DYN2 | DYNII dynamin 2 An unspecified isoform of Dyn2 interacts with Abi-1. This interaction was modeled on a demonstrated interaction between human Dyn2 and Abi-1 from an unspecified species. BIND 15696170
ENAH ENA | MENA | NDPP1 enabled homolog (Drosophila) - HPRD,BioGRID 12672821
EPS8 - epidermal growth factor receptor pathway substrate 8 - HPRD 1049958|9010225
|11099046|12127568
EPS8 - epidermal growth factor receptor pathway substrate 8 Affinity Capture-Western
Reconstituted Complex		 BioGRID 9010225|11099046
|14565974
EPS8L1 DRC3 | EPS8R1 | FLJ20258 | MGC23164 | MGC4642 | PP10566 EPS8-like 1 - HPRD,BioGRID 14565974
EPS8L2 EPS8R2 | FLJ16738 | FLJ21935 | FLJ22171 | MGC126530 | MGC3088 EPS8-like 2 Affinity Capture-Western BioGRID 14565974
EPS8L3 EPS8R3 | FLJ21522 | MGC16817 EPS8-like 3 Affinity Capture-Western BioGRID 14565974
HSPA8 HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71 heat shock 70kDa protein 8 - HPRD 15048123
NCF1C SH3PXD1C neutrophil cytosolic factor 1C pseudogene ABI-1 interacts with p47phox. BIND 12681507
NCK1 MGC12668 | NCK | NCKalpha NCK adaptor protein 1 - HPRD,BioGRID 11418237
NCK2 GRB4 | NCKbeta NCK adaptor protein 2 - HPRD 11557983
NCKAP1 FLJ11291 | HEM2 | KIAA0587 | MGC8981 | NAP1 | NAP125 NCK-associated protein 1 Affinity Capture-Western
Two-hybrid		 BioGRID 11418237
NCKAP1 FLJ11291 | HEM2 | KIAA0587 | MGC8981 | NAP1 | NAP125 NCK-associated protein 1 Nap1 interacts with hNap1BP. BIND 11418237
NIN KIAA1565 ninein (GSK3B interacting protein) - HPRD 15048123
PAK2 PAK65 | PAKgamma p21 protein (Cdc42/Rac)-activated kinase 2 - HPRD 11956071
SOS1 GF1 | GGF1 | GINGF | HGF | NS4 son of sevenless homolog 1 (Drosophila) - HPRD,BioGRID 10499589
SOS2 FLJ25596 son of sevenless homolog 2 (Drosophila) - HPRD 11003655


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID ECADHERIN NASCENT AJ PATHWAY 39 33 All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY 105 78 All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY 129 103 All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY 42 34 All SZGR 2.0 genes in this pathway
PID RAC1 REG PATHWAY 38 25 All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY 33 24 All SZGR 2.0 genes in this pathway
PID RAC1 PATHWAY 54 37 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255 177 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN 712 443 All SZGR 2.0 genes in this pathway
XU AKT1 TARGETS 6HR 27 18 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
KENNY CTNNB1 TARGETS UP 50 30 All SZGR 2.0 genes in this pathway
CHANG POU5F1 TARGETS UP 15 10 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP 555 346 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882 506 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-181 131 137 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU