Gene Page:TOM1
Summary?
GeneID | 10043 |
Symbol | TOM1 |
Synonyms | - |
Description | target of myb1 membrane trafficking protein |
Reference | MIM:604700|HGNC:HGNC:11982|Ensembl:ENSG00000100284|HPRD:05265|Vega:OTTHUMG00000150958 |
Gene type | protein-coding |
Map location | 22q13.1 |
Pascal p-value | 0.58 |
Sherlock p-value | 0.279 |
Fetal beta | -1.747 |
DMG | 2 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg05531055 | 22 | 35695625 | TOM1 | -0.027 | 0.29 | DMG:Nishioka_2013 | |
cg05531055 | 22 | 35695625 | TOM1 | 8.06E-8 | -0.011 | 1.88E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TOM1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SFRS9 | 0.95 | 0.93 |
RANBP1 | 0.93 | 0.89 |
AC026691.1 | 0.92 | 0.90 |
RNASEH2A | 0.92 | 0.92 |
DDX39 | 0.91 | 0.90 |
BAT4 | 0.91 | 0.89 |
H2AFY | 0.91 | 0.90 |
U2AF1 | 0.91 | 0.89 |
SNRPF | 0.90 | 0.85 |
SFRS3 | 0.90 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.33 | -0.69 | -0.85 |
AF347015.27 | -0.68 | -0.83 |
MT-CO2 | -0.68 | -0.82 |
HLA-F | -0.68 | -0.77 |
AF347015.31 | -0.68 | -0.81 |
MT-CYB | -0.67 | -0.83 |
AF347015.15 | -0.66 | -0.85 |
AF347015.8 | -0.66 | -0.83 |
AF347015.2 | -0.65 | -0.84 |
AF347015.9 | -0.64 | -0.84 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 14613930 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006897 | endocytosis | NAS | 10329004 | |
GO:0006886 | intracellular protein transport | IEA | - | |
GO:0016197 | endosome transport | NAS | 14613930 | |
GO:0016197 | endosome transport | TAS | 10329004 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005813 | centrosome | IDA | 18029348 | |
GO:0005829 | cytosol | IDA | 14613930 | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005764 | lysosome | TAS | 10329004 | |
GO:0005768 | endosome | TAS | 10329004 | |
GO:0005769 | early endosome | IDA | 14613930 | |
GO:0016020 | membrane | IDA | 14613930 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
CREIGHTON AKT1 SIGNALING VIA MTOR DN | 23 | 16 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM RISK UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G5 | 12 | 8 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-126/126-3p | 539 | 545 | 1A | hsa-miR-126brain | UCGUACCGUGAGUAAUAAUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.