Gene Page:TOM1

Summary?
GeneID 10043
Symbol TOM1
Synonyms -
Description target of myb1 membrane trafficking protein
Reference MIM:604700|HGNC:HGNC:11982|Ensembl:ENSG00000100284|HPRD:05265|Vega:OTTHUMG00000150958
Gene type protein-coding
Map location 22q13.1
Pascal p-value 0.58
Sherlock p-value 0.279
Fetal beta -1.747
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg05531055 22 35695625 TOM1 -0.027 0.29 DMG:Nishioka_2013
cg05531055 22 35695625 TOM1 8.06E-8 -0.011 1.88E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SFRS9 0.95 0.93
RANBP1 0.93 0.89
AC026691.1 0.92 0.90
RNASEH2A 0.92 0.92
DDX39 0.91 0.90
BAT4 0.91 0.89
H2AFY 0.91 0.90
U2AF1 0.91 0.89
SNRPF 0.90 0.85
SFRS3 0.90 0.92
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.33 -0.69 -0.85
AF347015.27 -0.68 -0.83
MT-CO2 -0.68 -0.82
HLA-F -0.68 -0.77
AF347015.31 -0.68 -0.81
MT-CYB -0.67 -0.83
AF347015.15 -0.66 -0.85
AF347015.8 -0.66 -0.83
AF347015.2 -0.65 -0.84
AF347015.9 -0.64 -0.84

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 14613930
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006897 endocytosis NAS 10329004
GO:0006886 intracellular protein transport IEA -
GO:0016197 endosome transport NAS 14613930
GO:0016197 endosome transport TAS 10329004
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005813 centrosome IDA 18029348
GO:0005829 cytosol IDA 14613930
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm IEA -
GO:0005764 lysosome TAS 10329004
GO:0005768 endosome TAS 10329004
GO:0005769 early endosome IDA 14613930
GO:0016020 membrane IDA 14613930

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID CMYB PATHWAY 84 61 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
CREIGHTON AKT1 SIGNALING VIA MTOR DN 23 16 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP 239 157 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN 394 258 All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP 108 66 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN 382 224 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP 121 71 All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN 228 146 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238 145 All SZGR 2.0 genes in this pathway
HOFMANN MYELODYSPLASTIC SYNDROM RISK UP 24 14 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G5 12 8 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN 428 246 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-126/126-3p 539 545 1A hsa-miR-126brain UCGUACCGUGAGUAAUAAUGC