Gene Page:DPP3
Summary?
GeneID | 10072 |
Symbol | DPP3 |
Synonyms | DPPIII |
Description | dipeptidyl肽酶3 |
Reference | MIM:606818|HGNC:HGNC:3008|Ensembl:ENSG00000254986|HPRD:06012|Vega:OTTHUMG00000167143 |
Gene type | protein-coding |
Map location | 11q13.2 |
Pascal p-value | 0.007 |
Sherlock p-value | 0.453 |
Fetal beta | 0.886 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
Expression | Meta-analysis of gene expression | Pvalue: 1.547 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg20808145 | 11 | 66025705 | DPP3 | 2.698E-4 | 3.407 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12296921 | chr12 | 60406485 | DPP3 | 10072 | 0.17 | trans | ||
rs8045342 | chr16 | 55138037 | DPP3 | 10072 | 0.1 | trans | ||
rs4783875 | chr16 | 55143190 | DPP3 | 10072 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/DPP3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MEGF11 | 0.47 | 0.26 |
AC079210.1 | 0.47 | 0.22 |
CARD11 | 0.45 | 0.29 |
GNG13 | 0.45 | 0.34 |
SMPX | 0.44 | 0.31 |
ADCY8 | 0.44 | 0.24 |
CCDC136 | 0.43 | 0.23 |
SUSD2 | 0.43 | 0.30 |
CASQ2 | 0.43 | 0.24 |
AL133445.2 | 0.42 | 0.22 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RPL31 | -0.23 | -0.32 |
C6orf48 | -0.22 | -0.25 |
AC008073.1 | -0.21 | -0.25 |
FTHL16 | -0.21 | -0.21 |
FAM128A | -0.21 | -0.25 |
GTF3C6 | -0.21 | -0.24 |
RPS20 | -0.20 | -0.30 |
RPL17P20 | -0.20 | -0.23 |
RPL34 | -0.20 | -0.26 |
RPS24 | -0.20 | -0.28 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004177 | aminopeptidase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008239 | dipeptidyl-peptidase activity | TAS | 10387075 | |
GO:0008237 | metallopeptidase activity | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | TAS | 10387075 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY DN | 138 | 70 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER | 140 | 73 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON | 158 | 93 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 2D UP | 69 | 46 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 116 | 123 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-148/152 | 207 | 213 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-34/449 | 209 | 216 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.