Gene Page:PTPRU
Summary?
GeneID | 10076 |
Symbol | PTPRU |
Synonyms | FMI|PCP-2|PTP|PTP-J|PTP-PI|PTP-RO|PTPPSI|PTPRO|PTPU2|R-PTP-PSI|R-PTP-U|hPTP-J |
Description | protein tyrosine phosphatase, receptor type U |
Reference | MIM:602454|HGNC:HGNC:9683|Ensembl:ENSG00000060656|HPRD:03908|Vega:OTTHUMG00000003699 |
Gene type | protein-coding |
Map location | 1p35.3 |
Pascal p-value | 0.079 |
Sherlock p-value | 0.896 |
Fetal beta | -0.192 |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0036 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17027208 | chr3 | 31219519 | PTPRU | 10076 | 0.06 | trans | ||
rs10994209 | chr10 | 61877705 | PTPRU | 10076 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PTPRU_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005001 | transmembrane receptor protein tyrosine phosphatase activity | TAS | 8700514 | |
GO:0004872 | receptor activity | IEA | - | |
GO:0004725 | protein tyrosine phosphatase activity | IEA | - | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0016791 | phosphatase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | TAS | 8700514 | |
GO:0006464 | 蛋白质改性过程 | TAS | 8700514 | |
GO:0006470 | protein amino acid dephosphorylation | IEA | - | |
GO:0007185 | transmembrane receptor protein tyrosine phosphatase signaling pathway | TAS | 8700514 | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 8700514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
圣干扰素γPATHWAY | 10 | 7 | All SZGR 2.0 genes in this pathway |
ST JAK STAT PATHWAY | 9 | 8 | All SZGR 2.0 genes in this pathway |
ST STAT3 PATHWAY | 11 | 10 | All SZGR 2.0 genes in this pathway |
ST TYPE I INTERFERON PATHWAY | 9 | 8 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
CHANG IMMORTALIZED BY HPV31 DN | 65 | 45 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
MALONEY RESPONSE TO 17AAG UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-219 | 795 | 801 | m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.