Gene Page:PTPRU

Summary?
GeneID 10076
Symbol PTPRU
Synonyms FMI|PCP-2|PTP|PTP-J|PTP-PI|PTP-RO|PTPPSI|PTPRO|PTPU2|R-PTP-PSI|R-PTP-U|hPTP-J
Description protein tyrosine phosphatase, receptor type U
Reference MIM:602454|HGNC:HGNC:9683|Ensembl:ENSG00000060656|HPRD:03908|Vega:OTTHUMG00000003699
Gene type protein-coding
Map location 1p35.3
Pascal p-value 0.079
Sherlock p-value 0.896
Fetal beta -0.192
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0036

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17027208 chr3 31219519 PTPRU 10076 0.06 trans
rs10994209 chr10 61877705 PTPRU 10076 0.01 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005001 transmembrane receptor protein tyrosine phosphatase activity TAS 8700514
GO:0004872 receptor activity IEA -
GO:0004725 protein tyrosine phosphatase activity IEA -
GO:0016787 hydrolase activity IEA -
GO:0016791 phosphatase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007155 cell adhesion TAS 8700514
GO:0006464 蛋白质改性过程 TAS 8700514
GO:0006470 protein amino acid dephosphorylation IEA -
GO:0007185 transmembrane receptor protein tyrosine phosphatase signaling pathway TAS 8700514
GO:0008150 biological_process ND -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005575 cellular_component ND -
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 8700514

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
圣干扰素γPATHWAY 10 7 All SZGR 2.0 genes in this pathway
ST JAK STAT PATHWAY 9 8 All SZGR 2.0 genes in this pathway
ST STAT3 PATHWAY 11 10 All SZGR 2.0 genes in this pathway
ST TYPE I INTERFERON PATHWAY 9 8 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255 177 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN 65 45 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
MALONEY RESPONSE TO 17AAG UP 41 26 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN 209 137 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142 103 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-219 795 801 m8 hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU