Gene Page:FRY
Summary?
GeneID | 10129 |
Symbol | FRY |
Synonyms | 13CDNA73|214K23.2|C13orf14|CG003|bA207N4.2|bA37E23.1 |
Description | FRY microtubule binding protein |
Reference | MIM:614818|HGNC:HGNC:20367|Ensembl:ENSG00000073910|HPRD:10821|Vega:OTTHUMG00000016696 |
Gene type | protein-coding |
Map location | 13q13.1 |
Pascal p-value | 0.414 |
Sherlock p-value | 0.657 |
Fetal beta | -0.679 |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
PMID:cooccur | High-throughput literature-search | 系统搜索我n PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
FRY | chr13 | 32786449 | A | G | NM_023037 | p.1538T>A | missense | Schizophrenia | DNM:Gulsuner_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/FRY_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005524 | ATP binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN | 52 | 34 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA MYELOID UP | 30 | 19 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS RED DN | 25 | 19 | All SZGR 2.0 genes in this pathway |
BILBAN B CLL LPL UP | 63 | 39 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION DN | 68 | 41 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 10HR DN | 56 | 37 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
开罗肝母细胞癌类DN | 210 | 141 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-141/200a | 1010 | 1016 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-15/16/195/424/497 | 619 | 625 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-204/211 | 548 | 555 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-25/32/92/363/367 | 356 | 362 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-338 | 46 | 52 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-376c | 1066 | 1073 | 1A,m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-503 | 619 | 625 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-9 | 295 | 301 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.