Gene Page:CTDSPL
Summary?
GeneID | 10217 |
Symbol | CTDSPL |
Synonyms | C3orf8|HYA22|PSR1|RBSP3|SCP3 |
Description | CTD small phosphatase like |
Reference | MIM:608592|HGNC:HGNC:16890|Ensembl:ENSG00000144677|Vega:OTTHUMG00000155942 |
Gene type | protein-coding |
Map location | 3p21.3 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.864 |
基因数据来源
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CTDSPL_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去你rm | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
去:0003674 | molecular_function | ND | - | |
去:0004721 | phosphoprotein phosphatase activity | IEA | - | |
去:0016787 | hydrolase activity | IEA | - | |
Biological process | 去你rm | Evidence | Neuro keywords | PubMed ID |
去:0008150 | biological_process | ND | - | |
Cellular component | 去你rm | Evidence | Neuro keywords | PubMed ID |
去:0005575 | cellular_component | ND | - | |
去:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID BMP PATHWAY | 42 | 31 | All SZGR 2.0 genes in this pathway |
PID SMAD2 3PATHWAY | 17 | 13 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
SU PANCREAS | 54 | 30 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D DN | 78 | 34 | All SZGR 2.0 genes in this pathway |
FLOTHO PEDIATRIC ALL THERAPY RESPONSE UP | 53 | 33 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS DN | 213 | 127 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 1099 | 1105 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-124.1 | 1958 | 1965 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 398 | 404 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
mir - 128 | 1051 | 1057 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-137 | 2475 | 2482 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-15/16/195/424/497 | 992 | 999 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-18 | 2342 | 2349 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-181 | 406 | 412 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU | ||||
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 3576 | 3582 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-183 | 2624 | 2631 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-218 | 1351 | 1357 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-339 | 1098 | 1104 | m8 | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
miR-493-5p | 2401 | 2407 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-503 | 993 | 999 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-504 | 1100 | 1107 | 1A,m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
miR-505 | 1999 | 2005 | m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
miR-543 | 2513 | 2519 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
hsa-miR-543 | AAACAUUCGCGGUGCACUUCU | ||||
miR-96 | 3576 | 3582 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
miR-99/100 | 2545 | 2552 | 1A,m8 | hsa-miR-99abrain | AACCCGUAGAUCCGAUCUUGUG |
hsa-miR-100brain | AACCCGUAGAUCCGAACUUGUG | ||||
hsa-miR-99bbrain | CACCCGUAGAACCGACCUUGCG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.