Gene Page:GPHN

Summary?
GeneID 10243
Symbol GPHN
Synonyms GEPH|GPH|GPHRYN|HKPX1|MOCODC
Description gephyrin
Reference MIM:603930|HGNC:HGNC:15465|Ensembl:ENSG00000171723|HPRD:04893|Vega:OTTHUMG00000029785
Gene type protein-coding
Map location 14q23.3
Pascal p-value 0.046
Sherlock p-value 0.021
Fetal beta 0.343
eGene Cerebellar Hemisphere
Myers' cis & trans
Support G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统的海rch in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression Meta-analysis of gene expression Pvalue: 2.648
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1020772 chr9 76532511 GPHN 10243 0.11 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SPTLC1 0.82 0.82
C14orf100 0.81 0.83
PAIP2 0.80 0.80
C6orf211 0.80 0.81
WDR51B 0.79 0.76
KIAA1279 0.79 0.80
COG6 0.79 0.76
USO1 0.78 0.73
UBAP1 0.78 0.77
ERGIC2 0.77 0.73
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
IL32 -0.50 -0.37
AF347015.18 -0.49 -0.36
AC100783.1 -0.44 -0.37
AC098691.2 -0.44 -0.32
AF347015.21 -0.44 -0.23
MT-CO2 -0.42 -0.28
AC010300.1 -0.41 -0.39
AF347015.2 -0.41 -0.27
AF347015.26 -0.40 -0.27
AF347015.8 -0.39 -0.26

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0000287 magnesium ion binding IEA -
GO:0003824 catalytic activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007529 establishment of synaptic specificity at neuromuscular junction IEA neuron, Synap (GO term level: 11) -
GO:0006777 Mo-molybdopterin cofactor biosynthetic process IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0045211 postsynaptic membrane IEA Synap, Neurotransmitter (GO term level: 5) -
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0005856 cytoskeleton IEA -
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm IEA -
GO:0005886 plasma membrane IEA -
GO:0030054 cell junction IEA -

部分诉通路注释

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA GABA PATHWAY 10 10 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF VITAMINS AND COFACTORS 51 36 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE DN 76 52 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR 532 309 All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2 43 38 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 126 78 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196 137 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP 89 62 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP 163 102 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP 176 110 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP 80 54 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397 206 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-138 742 748 1A hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-141/200a 736 742 1A hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-145 600 606 m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-153 61 67 1A hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-190 36 43 1A,m8 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
miR-24* 383 390 1A,m8 hsa-miR-189 GUGCCUACUGAGCUGAUAUCAGU
miR-299-3p 34 40 1A hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
miR-330 240 246 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-361 263 269 m8 hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC
miR-375 694 700 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-448 60 67 1A,m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-539 317 323 1A hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
miR-543 780 786 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-544 302 308 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU