Gene Page:SF3B4
Summary?
GeneID | 10262 |
象征 | SF3B4 |
Synonyms | AFD1|Hsh49|SAP49|SF3b49 |
Description | splicing factor 3b subunit 4 |
Reference | MIM:605593|HGNC:HGNC:10771|Ensembl:ENSG00000143368|HPRD:12028|Vega:OTTHUMG00000012208 |
Gene type | protein-coding |
Map location | 1q21.2 |
Sherlock p-value | 0.164 |
Fetal beta | 0.058 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg03952484 | 1 | 149899818 | SF3B4 | 1.83E-10 | -0.013 | 5.29E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SF3B4_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26conception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SH3BP5L | 0.91 | 0.93 |
RNF40 | 0.91 | 0.93 |
LRRC47 | 0.91 | 0.93 |
PRCC | 0.91 | 0.93 |
FAM171A2 | 0.91 | 0.94 |
PIK3R2 | 0.91 | 0.93 |
STRN4 | 0.90 | 0.93 |
LASP1 | 0.90 | 0.93 |
TRIM46 | 0.90 | 0.94 |
YY1 | 0.89 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.80 | -0.89 |
AF347015.31 | -0.79 | -0.87 |
AF347015.33 | -0.79 | -0.86 |
AF347015.27 | -0.78 | -0.87 |
MT-CYB | -0.77 | -0.87 |
AF347015.8 | -0.76 | -0.87 |
S100B | -0.75 | -0.82 |
FXYD1 | -0.74 | -0.82 |
COPZ2 | -0.74 | -0.80 |
HLA-F | -0.74 | -0.76 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003676 | nucleic acid binding | IEA | - | |
GO:0003723 | RNA binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 14667819 | |
GO:0031202 | RNA splicing factor activity, transesterification mechanism | TAS | 7958871 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
GO:0000398 | nuclear mRNA splicing, via spliceosome | IC | 9731529 | |
GO:0008380 | RNA splicing | TAS | 7958871 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005681 | spliceosome | IDA | 9731529 |
第四节。安。蛋白质间交互作用otation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BMPR1A | 10q23del | ACVRLK3 | ALK3 | CD292 | bone morphogenetic protein receptor, type IA | - | HPRD,BioGRID | 15351706 |
FAM115A | KIAA0738 | family with sequence similarity 115, member A | Two-hybrid | BioGRID | 16189514 |
MAPK9 | JNK-55 | JNK2 | JNK2A | JNK2ALPHA | JNK2B | JNK2BETA | PRKM9 | SAPK | p54a | p54aSAPK | mitogen-activated protein kinase 9 | Two-hybrid | BioGRID | 16189514 |
NCK2 | GRB4 | NCKbeta | NCK adaptor protein 2 | Two-hybrid | BioGRID | 16189514 |
PHF5A | INI | MGC1346 | SF3b14b | bK223H9.2 | PHD finger protein 5A | - | HPRD | 12234937 |
RNU11 | U11 | RNA, U11 small nuclear | Affinity Capture-MS | BioGRID | 15146077 |
RNU12 | U12 | RNA, U12 small nuclear | Affinity Capture-MS | BioGRID | 15146077 |
SF3A2 | PRP11 | PRPF11 | SAP62 | SF3a66 | splicing factor 3a, subunit 2, 66kDa | Affinity Capture-MS | BioGRID | 12234937 |
SF3B1 | PRP10 | PRPF10 | SAP155 | SF3b155 | splicing factor 3b, subunit 1, 155kDa | Affinity Capture-MS | BioGRID | 12234937 |
SF3B14 | CGI-110 | HSPC175 | Ht006 | P14 | SAP14 | SF3B14a | splicing factor 3B, 14 kDa subunit | - | HPRD | 12234937|12738865 |
SF3B2 | SAP145 | SF3B145 | SF3b1 | SF3b150 | splicing factor 3b, subunit 2, 145kDa | SAP145 interacts with SAP49. | BIND | 7958871 |
SF3B2 | SAP145 | SF3B145 | SF3b1 | SF3b150 | splicing factor 3b, subunit 2, 145kDa | in vivo Two-hybrid |
BioGRID | 7958871|16189514 |
SF3B2 | SAP145 | SF3B145 | SF3b1 | SF3b150 | splicing factor 3b, subunit 2, 145kDa | - | HPRD | 7958871|10490618 |
SMNDC1 | SMNR | SPF30 | survival motor neuron domain containing 1 | Affinity Capture-MS | BioGRID | 17353931 |
SS18L1 | CREST | KIAA0693 | LP2261 | MGC26711 | MGC78386 | synovial sarcoma translocation gene on chromosome 18-like 1 | Two-hybrid | BioGRID | 16189514 |
STK19 | D6S60 | D6S60E | G11 | HLA-RP1 | MGC117388 | RP1 | serine/threonine kinase 19 | - | HPRD | 14667819 |
TCERG1 | CA150 | MGC133200 | TAF2S | transcription elongation regulator 1 | - | HPRD,BioGRID | 15456888 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA SPLICING MINOR PATHWAY | 45 | 19 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
JAZAERI BREAST CANCER BRCA1 VS BRCA2 UP | 49 | 28 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 54 | 60 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.