Gene Page:TNIP1
Summary?
GeneID | 10318 |
Symbol | TNIP1 |
Synonyms | ABIN-1|NAF1|VAN|nip40-1 |
Description | TNFAIP3 interacting protein 1 |
Reference | MIM:607714|HGNC:HGNC:16903|Ensembl:ENSG00000145901|HPRD:09216|Vega:OTTHUMG00000163722 |
Gene type | protein-coding |
Map location | 5q33.1 |
Pascal p-value | 0.302 |
Sherlock p-value | 0.61 |
Fetal beta | -0.193 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg00110623 | 5 | 150461116 | TNIP1 | 2.76E-10 | -0.027 | 6.56E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TNIP1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MRPL9 | 0.87 | 0.85 |
SUMO2 | 0.85 | 0.90 |
LSM6 | 0.84 | 0.83 |
TBCA | 0.84 | 0.88 |
DNAJC8 | 0.84 | 0.84 |
SARNP | 0.83 | 0.85 |
SRP14 | 0.83 | 0.83 |
LSM3 | 0.83 | 0.86 |
THOC4 | 0.82 | 0.86 |
FAM32A | 0.82 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.33 | -0.65 | -0.72 |
AF347015.26 | -0.64 | -0.73 |
MT-CO2 | -0.64 | -0.67 |
APOL3 | -0.64 | -0.72 |
AF347015.9 | -0.64 | -0.74 |
HLA-F | -0.63 | -0.68 |
TINAGL1 | -0.63 | -0.71 |
AF347015.2 | -0.63 | -0.70 |
MT-CYB | -0.63 | -0.70 |
SLC6A12 | -0.61 | -0.67 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | TAS | 11090181 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0009101 | glycoprotein biosynthetic process | IDA | 9923610 | |
GO:0006412 | translation | TAS | 9923610 | |
GO:0009405 | pathogenesis | TAS | 9923610 | |
GO:0006952 | defense response | TAS | 9923610 | |
GO:0045071 | negative regulation of viral genome replication | TAS | 9923610 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | TAS | 9923610 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
DITTMER PTHLH TARGETS UP | 112 | 68 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP UP | 265 | 158 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
RASHI NFKB1 TARGETS | 19 | 18 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS INDUCED BY AKT1 48HR UP | 14 | 8 | All SZGR 2.0 genes in this pathway |
DIRMEIER LMP1 RESPONSE LATE UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPLICATION GENES | 147 | 87 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING UP | 83 | 56 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN | 85 | 67 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 4HR | 54 | 36 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C1 | 72 | 45 | All SZGR 2.0 genes in this pathway |
CREIGHTON内分泌治疗抵抗4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
SEKI INFLAMMATORY RESPONSE LPS UP | 77 | 56 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION B | 53 | 36 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS KERATINOCYTE UP | 91 | 63 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS LCP WITH H3K4ME3 | 174 | 100 | All SZGR 2.0 genes in this pathway |
TIAN TNF SIGNALING VIA NFKB | 28 | 21 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
FARDIN HYPOXIA 11 | 32 | 29 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-19 | 726 | 732 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-370 | 430 | 436 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.