Gene Page:TNIP1

Summary?
GeneID 10318
Symbol TNIP1
Synonyms ABIN-1|NAF1|VAN|nip40-1
Description TNFAIP3 interacting protein 1
Reference MIM:607714|HGNC:HGNC:16903|Ensembl:ENSG00000145901|HPRD:09216|Vega:OTTHUMG00000163722
Gene type protein-coding
Map location 5q33.1
Pascal p-value 0.302
Sherlock p-value 0.61
Fetal beta -0.193
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_I Genome scan meta-analysis Psr: 0.0032
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00459
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01718

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg00110623 5 150461116 TNIP1 2.76E-10 -0.027 6.56E-7 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MRPL9 0.87 0.85
SUMO2 0.85 0.90
LSM6 0.84 0.83
TBCA 0.84 0.88
DNAJC8 0.84 0.84
SARNP 0.83 0.85
SRP14 0.83 0.83
LSM3 0.83 0.86
THOC4 0.82 0.86
FAM32A 0.82 0.86
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.33 -0.65 -0.72
AF347015.26 -0.64 -0.73
MT-CO2 -0.64 -0.67
APOL3 -0.64 -0.72
AF347015.9 -0.64 -0.74
HLA-F -0.63 -0.68
TINAGL1 -0.63 -0.71
AF347015.2 -0.63 -0.70
MT-CYB -0.63 -0.70
SLC6A12 -0.61 -0.67

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding TAS 11090181
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0009101 glycoprotein biosynthetic process IDA 9923610
GO:0006412 translation TAS 9923610
GO:0009405 pathogenesis TAS 9923610
GO:0006952 defense response TAS 9923610
GO:0045071 negative regulation of viral genome replication TAS 9923610
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular TAS 9923610
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380 215 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN 50 36 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN 180 101 All SZGR 2.0 genes in this pathway
DITTMER PTHLH TARGETS UP 112 68 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP 265 158 All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN 136 94 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2 127 92 All SZGR 2.0 genes in this pathway
RASHI NFKB1 TARGETS 19 18 All SZGR 2.0 genes in this pathway
XU HGF TARGETS INDUCED BY AKT1 48HR UP 14 8 All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE LATE UP 57 41 All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP 223 140 All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES 147 87 All SZGR 2.0 genes in this pathway
SANA TNF SIGNALING UP 83 56 All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS 183 115 All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN 85 67 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
NEMETH INFLAMMATORY RESPONSE LPS UP 88 64 All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 4HR 54 36 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN 178 121 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1 72 45 All SZGR 2.0 genes in this pathway
CREIGHTON内分泌治疗抵抗4 307 185 All SZGR 2.0 genes in this pathway
SEKI INFLAMMATORY RESPONSE LPS UP 77 56 All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B 53 36 All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP 91 63 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS LCP WITH H3K4ME3 174 100 All SZGR 2.0 genes in this pathway
TIAN TNF SIGNALING VIA NFKB 28 21 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN 207 139 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
FARDIN HYPOXIA 11 32 29 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882 506 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38 337 236 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-19 726 732 m8 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-370 430 436 1A hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG