Gene Page:BASP1

Summary?
GeneID 10409
Symbol BASP1
Synonyms CAP-23|CAP23|NAP-22|NAP22
Description brain abundant membrane attached signal protein 1
Reference MIM:605940|HGNC:HGNC:957|Ensembl:ENSG00000176788|HPRD:08389|Vega:OTTHUMG00000131061
Gene type protein-coding
Map location 5p15.1
Pascal p-value 0.043
Sherlock p-value 0.953
Fetal beta 0.711
DMG 1 (# studies)
Support INTRACELLULAR SIGNAL TRANSDUCTION
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg04713453 5 17217093 BASP1 7.54E-9 -0.026 3.72E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TSG101 0.92 0.93
ESD 0.92 0.93
EIF3M 0.91 0.92
CNOT10 0.90 0.91
IFT52 0.90 0.93
GTF2B 0.90 0.90
MRPL45 0.90 0.90
MMADHC 0.90 0.91
DAP3 0.90 0.90
CCT4 0.89 0.92
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.8 -0.76 -0.82
MT-CYB -0.76 -0.83
AF347015.27 -0.76 -0.81
MT-CO2 -0.75 -0.80
AF347015.33 -0.75 -0.82
AF347015.15 -0.75 -0.83
AF347015.2 -0.75 -0.83
AF347015.26 -0.75 -0.84
AF347015.31 -0.73 -0.78
HLA-F -0.69 -0.75

Section III. Gene Ontology annotation

Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0042995 cell projection IEA axon (GO term level: 4) -
GO:0005856 cytoskeleton TAS 9749536
GO:0005886 等离子体膜 TAS 9749536

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HOLLMANN APOPTOSIS VIA CD40 UP 201 125 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA DN 349 157 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS TOP50 UP 38 27 All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN 431 263 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN 460 312 All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP 95 64 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN 199 124 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN 67 43 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP 82 58 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP 214 144 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP 169 127 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HBZ 41 27 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 4 61 34 All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 2 42 31 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
SCIAN INVERSED TARGETS OF TP53 AND TP73 DN 31 23 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN 57 45 All SZGR 2.0 genes in this pathway
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN 45 33 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP 283 177 All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP 108 75 All SZGR 2.0 genes in this pathway
彭雷帕霉素的反应了 203 130 All SZGR 2.0 genes in this pathway
NADLER OBESITY UP 61 34 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366 238 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP 183 111 All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162 102 All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN 86 67 All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION 405 264 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS DN 57 42 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220 147 All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE DN 61 39 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D DN 64 35 All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS UP 48 31 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA DN 100 63 All SZGR 2.0 genes in this pathway
BEIER GLIOMA STEM CELL DN 66 42 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN 252 155 All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP 40 25 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
CROONQUIST STROMAL STIMULATION UP 60 42 All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION DN 99 65 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 15 31 19 All SZGR 2.0 genes in this pathway
VALK AML WITH CEBPA 37 27 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN 170 105 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368 247 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2 17 11 All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP 66 43 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA1 UP 101 66 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166 105 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA LB DN 44 23 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP 221 135 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED 228 119 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 5 30 22 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL 129 85 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN 505 328 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP 140 94 All SZGR 2.0 genes in this pathway
VANDESLUIS NORMAL EMBRYOS DN 25 13 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS UP 107 72 All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP 289 184 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-150 618 624 m8 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
miR-200bc/429 465 471 m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-324-5p 866 872 1A hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
miR-381 889 895 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-409-3p 630 636 m8 hsa-miR-409-3p CGAAUGUUGCUCGGUGAACCCCU
miR-493-5p 857 864 1A,m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-539 661 668 1A,m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
miR-7 780 786 1A hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG