基因页面:ARIH2
Summary?
| GeneID | 10425 |
| Symbol | ARIH2 |
| Synonyms | ARI2|TRIAD1 |
| Description | ariadne RBR E3 ubiquitin protein ligase 2 |
| Reference | MIM:605615|HGNC:HGNC:690|Ensembl:ENSG00000177479|HPRD:09286|Vega:OTTHUMG00000133547 |
| Gene type | protein-coding |
| Map location | 3p21 |
| Pascal p-value | 0.029 |
| Sherlock p-value | 0.275 |
| eGene | Frontal Cortex BA9 Meta |
Gene in Data Sources
| 基因集名称 | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.125 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MPG | 0.88 | 0.82 |
| CHCHD5 | 0.88 | 0.76 |
| YIF1A | 0.88 | 0.81 |
| ZNF511 | 0.88 | 0.76 |
| NDUFA11 | 0.87 | 0.77 |
| C11orf59 | 0.86 | 0.79 |
| COX8A | 0.86 | 0.78 |
| C17orf61 | 0.86 | 0.81 |
| TMEM223 | 0.85 | 0.76 |
| TRPT1 | 0.85 | 0.78 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| Z83840.4 | -0.44 | -0.51 |
| ZNHIT6 | -0.42 | -0.42 |
| TRAF3IP1 | -0.42 | -0.40 |
| TRIM44 | -0.40 | -0.40 |
| CCDC55 | -0.39 | -0.42 |
| RBM25 | -0.39 | -0.42 |
| KIF16B | -0.38 | -0.32 |
| AP000769.2 | -0.37 | -0.45 |
| SDCCAG1 | -0.37 | -0.31 |
| DST | -0.37 | -0.37 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008270 | zinc ion binding | TAS | 10422847 | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| GO:0007275 | multicellular organismal development | TAS | 10422847 | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | TAS | 10422847 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ARAP1 | CENTD2 | KIAA0782 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 | Two-hybrid | BioGRID | 16169070 |
| BUB1 | BUB1A | BUB1L | hBUB1 | budding uninhibited by benzimidazoles 1 homolog (yeast) | Two-hybrid | BioGRID | 16189514 |
| CBR3 | hCBR3 | carbonyl reductase 3 | Two-hybrid | BioGRID | 16169070 |
| DLST | DLTS | dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) | Two-hybrid | BioGRID | 16169070 |
| EEF1A1 | CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1 | eukaryotic translation elongation factor 1 alpha 1 | Two-hybrid | BioGRID | 16169070 |
| EEF1G | EF1G | GIG35 | eukaryotic translation elongation factor 1 gamma | Two-hybrid | BioGRID | 16169070 |
| EML4 | C2orf2 | DKFZp686P18118 | ELP120 | FLJ10942 | FLJ32318 | ROPP120 | echinoderm microtubule associated protein like 4 | Two-hybrid | BioGRID | 16169070 |
| ENSA | MGC4319 | MGC78563 | MGC8394 | endosulfine alpha | Two-hybrid | BioGRID | 16169070 |
| IL4R | CD124 | IL4RA | interleukin 4 receptor | Two-hybrid | BioGRID | 16169070 |
| KAT5 | ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2 | K(lysine) acetyltransferase 5 | Two-hybrid | BioGRID | 16169070 |
| KCNQ2 | BFNC | EBN | EBN1 | ENB1 | HNSPC | KCNA11 | KV7.2 | KVEBN1 | potassium voltage-gated channel, KQT-like subfamily, member 2 | Two-hybrid | BioGRID | 16169070 |
| KIAA1377 | - | KIAA1377 | Two-hybrid | BioGRID | 16169070 |
| LOC147791 | - | hypothetical protein LOC147791 | Two-hybrid | BioGRID | 16169070 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Two-hybrid | BioGRID | 16169070 |
| PTN | HARP | HBGF8 | HBNF | NEGF1 | pleiotrophin | Two-hybrid | BioGRID | 16169070 |
| RPL8 | - | ribosomal protein L8 | Two-hybrid | BioGRID | 16169070 |
| SCAMP2 | - | secretory carrier membrane protein 2 | Two-hybrid | BioGRID | 16169070 |
| SGCE | DYT11 | ESG | sarcoglycan, epsilon | Two-hybrid | BioGRID | 16169070 |
| SLC1A6 | EAAT4 | MGC33092 | MGC43671 | solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 | Two-hybrid | BioGRID | 16169070 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Two-hybrid | BioGRID | 16169070 |
| UBE2L3 | E2-F1 | L-UBC | UBCH7 | UbcM4 | ubiquitin-conjugating enzyme E2L 3 | Two-hybrid | BioGRID | 16169070 |
| UBE2L3 | E2-F1 | L-UBC | UBCH7 | UbcM4 | ubiquitin-conjugating enzyme E2L 3 | An unspecified isoform of UbcH7 interacts with hAri-2. | BIND | 12234920 |
| UGP2 | UDPG | UDPGP2 | UGPP2 | pHC379 | UDP-glucose pyrophosphorylase 2 | Two-hybrid | BioGRID | 16189514 |
| UTP14A | KIAA0266 | NY-CO-16 | SDCCAG16 | dJ537K23.3 | UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) | Two-hybrid | BioGRID | 16169070 |
| WDR91 | HSPC049 | WD repeat domain 91 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS I MHC MEDIATED ANTIGEN PROCESSING PRESENTATION | 251 | 156 | All SZGR 2.0 genes in this pathway |
| REACTOME ANTIGEN PROCESSING UBIQUITINATION PROTEASOME DEGRADATION | 212 | 129 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA MYELOID DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| GAL LEUKEMIC STEM CELL UP | 133 | 78 | All SZGR 2.0 genes in this pathway |
| WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
| MULLIGHANNPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
| MULLIGHANNPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
| MULLIGHANNPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| VANHARANTA UTERINE FIBROID WITH 7Q DELETION DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| HUMMERICH SKIN CANCER PROGRESSION UP | 88 | 58 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| MANTOVANI VIRAL GPCR SIGNALING DN | 49 | 37 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| FONTAINE FOLLICULAR THYROID ADENOMA UP | 75 | 43 | All SZGR 2.0 genes in this pathway |
| FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY UP | 36 | 23 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-10 | 185 | 191 | 1A | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
| hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
| miR-181 | 431 | 437 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-19 | 1062 | 1069 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-199 | 125 | 131 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-200bc/429 | 286 | 292 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-379 | 180 | 186 | 1A | hsa-miR-379brain | UGGUAGACUAUGGAACGUA |
| miR-382 | 300 | 307 | 1A,m8 | hsa - mir - 382brain | GAAGUUGUUCGUGGUGGAUUCG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.