Gene Page:DPYSL4

Summary?
GeneID 10570
Symbol DPYSL4
Synonyms CRMP3|DRP-4|ULIP4
Description dihydropyrimidinase like 4
Reference MIM:608407|HGNC:HGNC:3016|Ensembl:ENSG00000151640|HPRD:07463|Vega:OTTHUMG00000019283
Gene type protein-coding
Map location 10q26
Pascal p-value 0.167
Sherlock p-value 0.247
Fetal beta 0.648
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Cortex
Myers' cis & trans
元
Support STRUCTURAL PLASTICITY
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_clathrin
G2Cdb.human_Synaptosome
G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03487
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg04064828 10 134002751 DPYSL4 4.12E-4 0.672 0.044 DMG:Wockner_2014
cg03304019 10 133998913 DPYSL4 5.114E-4 0.42 0.047 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2035804 chr10 134034378 DPYSL4 10570 0.11 cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
YWHAE 0.93 0.91
HNRPLL 0.92 0.92
C11orf58 0.92 0.89
ARF4 0.91 0.91
MRPL3 0.91 0.90
CNOT7 0.91 0.91
ABCE1 0.91 0.90
VPS26A 0.91 0.90
TMED2 0.91 0.89
CUL2 0.91 0.90
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-CO2 -0.74 -0.76
AF347015.33 -0.72 -0.75
AF347015.8 -0.72 -0.76
MT-CYB -0.71 -0.74
AF347015.2 -0.70 -0.75
AF347015.31 -0.70 -0.74
AF347015.26 -0.69 -0.75
AF347015.15 -0.69 -0.75
FXYD1 -0.69 -0.76
AF347015.27 -0.67 -0.70

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016810 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9652388
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE 251 188 All SZGR 2.0 genes in this pathway
REACTOME CRMPS IN SEMA3A SIGNALING 14 14 All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS 68 53 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP 171 112 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP 130 85 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN 91 58 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN 104 72 All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800 473 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN 261 183 All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP 299 167 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250 168 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS 108 68 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 3 UP 170 97 All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 6 UP 140 81 All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS UP 217 131 All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS GROUP1 136 76 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN 106 77 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-125/351 535 541 1A hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-34/449 214 221 1A,m8 hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC