Gene Page:STAMBP
Summary?
GeneID | 10617 |
Symbol | STAMBP |
Synonyms | AMSH|MICCAP |
Description | STAM binding protein |
Reference | MIM: 606247|HGNC:HGNC:16950|Ensembl:ENSG00000124356|HPRD:05877|Vega:OTTHUMG00000129817 |
Gene type | protein-coding |
Map location | 2p13.1 |
Pascal p-value | 0.03 |
Sherlock p-value | 0.759 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0096 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MKKS | 0.86 | 0.84 |
TMEM111 | 0.86 | 0.84 |
PRKAG1 | 0.86 | 0.80 |
GABARAPL2 | 0.86 | 0.84 |
MRPS7 | 0.86 | 0.84 |
TMEM85 | 0.85 | 0.79 |
COPS4 | 0.85 | 0.83 |
TSFM | 0.85 | 0.80 |
SNX17 | 0.84 | 0.85 |
YIPF1 | 0.84 | 0.81 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.18 | -0.60 | -0.36 |
AF347015.2 | -0.52 | -0.25 |
AF347015.26 | -0.51 | -0.28 |
AC010300.1 | -0.51 | -0.50 |
AC100783.1 | -0.51 | -0.39 |
AF347015.8 | -0.49 | -0.25 |
MT-ATP8 | -0.48 | -0.26 |
C10orf108 | -0.48 | -0.43 |
AC016705.1 | -0.48 | -0.34 |
AF347015.21 | -0.47 | -0.20 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 10383417|14755250 | |
GO:0004221 | 泛素thiolesterase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008237 | metallopeptidase activity | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
GO:0007259 | JAK-STAT cascade | TAS | 10383417 | |
GO:0008284 | positive regulation of cell proliferation | TAS | 10383417 | |
GO:0006916 | anti-apoptosis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 10383417 | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
PID ERBB1 INTERNALIZATION PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
DACOSTA ERCC3 ALLELE XPCS VS TTD DN | 36 | 27 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
KIM GERMINAL CENTER T HELPER UP | 66 | 42 | All SZGR 2.0 genes in this pathway |
PEART HDAC PROLIFERATION CLUSTER UP | 57 | 35 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 10HR DN | 56 | 37 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 424 | 430 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.