Gene Page:POLR3F
Summary?
GeneID | 10621 |
Symbol | POLR3F |
Synonyms | RPC39|RPC6 |
Description | polymerase (RNA) III subunit F |
Reference | HGNC:HGNC:15763|Ensembl:ENSG00000132664|HPRD:15156|Vega:OTTHUMG00000031971 |
Gene type | protein-coding |
Map location | 20p11.23 |
Pascal p-value | 0.684 |
Sherlock p-value | 0.831 |
Fetal beta | 0.1 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.046 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14535006 | 20 | 18448030 | POLR3F | 7.14E-9 | -0.025 | 3.59E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6075348 | chr20 | 18473041 | POLR3F | 10621 | 0.06 | cis | ||
rs2247746 | chr20 | 18477613 | POLR3F | 10621 | 0.2 | cis | ||
rs7262824 | chr20 | 18483104 | POLR3F | 10621 | 0.09 | cis | ||
rs1022681 | chr20 | 18487013 | POLR3F | 10621 | 0.06 | cis | ||
rs1022684 | chr20 | 18487505 | POLR3F | 10621 | 0.15 | cis | ||
rs1109030 | chr20 | 18506676 | POLR3F | 10621 | 0.13 | cis | ||
rs1555354 | chr20 | 18506824 | POLR3F | 10621 | 0.04 | cis | ||
rs911011 | chr20 | 18717017 | POLR3F | 10621 | 0.14 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/POLR3F_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0003899 | DNA-directed RNA polymerase activity | NAS | 9171375 | |
GO:0005515 | protein binding | 新闻学会 | 16169070 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006359 | regulation of transcription from RNA polymerase III promoter | NAS | 9171375 | |
GO:0006350 | transcription | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005666 | DNA-directed RNA polymerase III complex | NAS | 10623476 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BDP1 | DKFZp686C01233 | DKFZp686K0831 | HSA238520 | KIAA1241 | KIAA1689 | TAF3B1 | TFC5 | TFIIIB'' | TFIIIB150 | TFIIIB90 | TFNR | B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB | - | HPRD | 9171375 |
BRF1 | BRF | FLJ42674 | FLJ43034 | GTF3B | MGC105048 | TAF3B2 | TAF3C | TAFIII90 | TF3B90 | TFIIIB90 | hBRF | BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) | - | HPRD | 9171375 |
C14orf1 | ERG28 | NET51 | chromosome 14 open reading frame 1 | Two-hybrid | BioGRID | 16169070 |
C1orf103 | FLJ11269 | RIF1 | RP11-96K19.1 | chromosome 1 open reading frame 103 | Two-hybrid | BioGRID | 16169070 |
GTF3C4 | FLJ21002 | KAT12 | MGC138450 | TFIII90 | TFIIIC90 | TFIIICdelta | TFiiiC2-90 | general transcription factor IIIC, polypeptide 4, 90kDa | - | HPRD,BioGRID | 10523658 |
KAT5 | ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2 | K(lysine) acetyltransferase 5 | Two-hybrid | BioGRID | 16169070 |
POLR3C | RPC3 | RPC62 | polymerase (RNA) III (DNA directed) polypeptide C (62kD) | - | HPRD,BioGRID | 9171375 |
POLR3D | BN51T | RPC4 | RPC53 | TSBN51 | polymerase (RNA) III (DNA directed) polypeptide D, 44kDa | Affinity Capture-MS | BioGRID | 12391170 |
POLR3G | RPC32 | RPC7 | polymerase (RNA) III (DNA directed) polypeptide G (32kD) | - | HPRD | 9171375 |
PRPF4B | KIAA0536 | PR4H | PRP4 | PRP4H | PRP4K | dJ1013A10.1 | PRP4 pre-mRNA processing factor 4 homolog B (yeast) | Two-hybrid | BioGRID | 16169070 |
STC2 | STC-2 | STCRP | stanniocalcin 2 | Two-hybrid | BioGRID | 16169070 |
TBP | GTF2D | GTF2D1 | MGC117320 | MGC126054 | MGC126055 | SCA17 | TFIID | TATA box binding protein | - | HPRD,BioGRID | 9171375 |
WDR89 | C14orf150 | MGC9907 | MSTP050 | WD repeat domain 89 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
KEGG PYRIMIDINE METABOLISM | 98 | 53 | All SZGR 2.0 genes in this pathway |
KEGG RNA POLYMERASE | 29 | 12 | All SZGR 2.0 genes in this pathway |
KEGG CYTOSOLIC DNA SENSING PATHWAY | 56 | 44 | All SZGR 2.0 genes in this pathway |
REACTOME RNA聚合酶III转录起始TYPE 2 PROMOTER | 23 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME RNA POL III TRANSCRIPTION | 33 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTION | 210 | 127 | All SZGR 2.0 genes in this pathway |
REACTOME RNA POL I RNA POL III AND MITOCHONDRIAL TRANSCRIPTION | 122 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME RNA聚合酶III转录起始TYPE 3 PROMOTER | 26 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME RNA POL III TRANSCRIPTION TERMINATION | 19 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME RNA POL III CHAIN ELONGATION | 17 | 8 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
TERAO AOX4 TARGETS SKIN UP | 38 | 27 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-15/16/195/424/497 | 122 | 129 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-503 | 123 | 129 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.