Gene Page:RGS14

Summary?
GeneID 10636
Symbol RGS14
Synonyms -
Description regulator of G-protein signaling 14
Reference MIM:602513|HGNC:HGNC:9996|Ensembl:ENSG00000169220|HPRD:03944|Vega:OTTHUMG00000163324
Gene type protein-coding
Map location 5q35.3
Pascal p-value 0.12
Sherlock p-value 0.031
Fetal beta -0.9
eGene Cerebellum
Frontal Cortex BA9
Myers' cis & trans
元

Gene in Data Sources
Gene set name Method of gene set Description Info
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.0276
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0036

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16865055 chr2 224523383 RGS14 10636 0.07 trans
rs16922710 chr10 23087297 RGS14 10636 0.13 trans
rs443222 chr16 83889679 RGS14 10636 0.08 trans
rs824575 chr16 83891459 RGS14 10636 0.08 trans
rs1883665 chrX 17650382 RGS14 10636 0.12 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AC113191.1 0.93 0.90
ZNF121 0.88 0.88
PCDHB11 0.87 0.84
ZNF852 0.85 0.82
GATAD2B 0.85 0.91
IGF1R 0.85 0.90
RC3H1 0.84 0.85
KIAA1853 0.84 0.83
RAD54L2 0.84 0.92
TMEM213 0.84 0.81
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SERPINB6 -0.52 -0.68
C5orf53 -0.50 -0.69
AF347015.31 -0.49 -0.79
LHPP -0.49 -0.52
HSD17B14 -0.49 -0.71
AF347015.27 -0.49 -0.78
ACOT13 -0.48 -0.61
MT-CO2 -0.48 -0.78
IFI27 -0.48 -0.76
S100B -0.48 -0.74

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005057 receptor signaling protein activity IEA -
GO:0005096 GTPase activator activity TAS 9168931
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0009968 negative regulation of signal transduction IEA -
GO:0008277 regulation of G-protein coupled receptor protein signaling pathway TAS 9168931
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU SOX4 TARGETS DN 309 191 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN 187 115 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA PROGRESSION RISK 74 44 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN 261 155 All SZGR 2.0 genes in this pathway
MORI PRE BI LYMPHOCYTE DN 77 49 All SZGR 2.0 genes in this pathway
MORI LARGE PRE BII LYMPHOCYTE DN 58 39 All SZGR 2.0 genes in this pathway
MORI IMMATURE B LYMPHOCYTE UP 53 35 All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE UP 90 62 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN 225 163 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS DN 74 55 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN 165 106 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING 246 152 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF LCP WITH H3K27ME3 70 35 All SZGR 2.0 genes in this pathway
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS UP 84 51 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-324-3p 294 300 m8 hsa-miR-324-3p CCACUGCCCCAGGUGCUGCUGG