Gene Page:CAMKK2

Summary?
GeneID 10645
Symbol CAMKK2
Synonyms CAMKK|CAMKKB
Description calcium/calmodulin-dependent protein kinase kinase 2
Reference MIM:615002|HGNC:HGNC:1470|Ensembl:ENSG00000110931|HPRD:06467|Vega:OTTHUMG00000169156
Gene type protein-coding
Map location 12q24.2
Pascal p-value 0.02
Sherlock p-value 0.681
DEG p-value DEG:Maycox_2009:CC_BA10_fold_change=-1.16:CC_BA10_disease_P=0.0165:HBB_BA9_fold_change=-1.49:HBB_BA9_disease_P=0.0230
Fetal beta -1.531
DMG 1 (# studies)
eGene Myers' cis & trans
Meta
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DEG:Maycox_2009 Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue We included 51 genes whose expression changes are common between two schizophrenia cohorts.
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与Sc Co-occurancehizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg13839391 12 121719066 CAMKK2 1.052E-4 0.351 0.028 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs208296 chr12 121600952 CAMKK2 10645 0.13 cis
rs2071272 chr12 121670791 CAMKK2 10645 0.01 cis
rs2252304 chr12 121673599 CAMKK2 10645 0.05 cis
rs2567982 chr12 121675713 CAMKK2 10645 0 cis
rs1063843 chr12 121681686 CAMKK2 10645 0.18 cis
rs2288693 chr12 121687473 CAMKK2 10645 0.02 cis
rs2079965 chr7 71227723 CAMKK2 10645 0.14 trans
rs2567982 chr12 121675713 CAMKK2 10645 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
共有269个时间点秘密策划,n = 38胎儿samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005509 calcium ion binding IDA 11395482
GO:0005516 calmodulin binding TAS 11395482
GO:0005524 ATP binding IEA -
GO:0004683 calmodulin-dependent protein kinase activity IEA -
GO:0004713 protein tyrosine kinase activity TAS 11395482
GO:0016740 transferase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0000165 MAPKKK cascade TAS 11395482
GO:0019722 calcium-mediated signaling TAS 11395482
GO:0045941 positive regulation of transcription TAS 11395482
GO:0045859 regulation of protein kinase activity TAS 11395482
GO:0046777 protein amino acid autophosphorylation IDA 11395482
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005622 intracellular TAS 11395482
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ADIPOCYTOKINE SIGNALING PATHWAY 67 57 All SZGR 2.0 genes in this pathway
BIOCARTA CACAM PATHWAY 16 11 All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY 69 57 All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER UP 96 57 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO ANDROGEN UP 29 21 All SZGR 2.0 genes in this pathway
王FORSKOLIN反应 23 17 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404 246 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN 126 86 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162 116 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN 485 334 All SZGR 2.0 genes in this pathway
LUCAS HNF4A TARGETS UP 58 36 All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP 47 32 All SZGR 2.0 genes in this pathway
TOMLINS PROSTATE CANCER UP 40 27 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER 80 52 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN 103 71 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN 261 155 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165 104 All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP 53 40 All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L1 G1 DN 12 6 All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN UP 86 61 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP 151 100 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN 165 106 All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 419 273 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
FIRESTEIN CTNNB1 PATHWAY 33 23 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D CLUSTER DN 40 26 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3 UNMETHYLATED 37 21 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED 228 119 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS 239 156 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-153 2849 2855 m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-25/32/92/363/367 1853 1859 1A hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-29 2717 2723 1A hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-30-5p 1987 1994 1A,m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-329 98 104 1A hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-342 226 232 m8 hsa-miR-342brain UCUCACACAGAAAUCGCACCCGUC
miR-378 597 604 1A,m8 hsa-miR-378 CUCCUGACUCCAGGUCCUGUGU
miR-9 2153 2160 1A,m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA