Gene Page:MTX2
Summary?
GeneID | 10651 |
Symbol | MTX2 |
Synonyms | - |
Description | metaxin 2 |
Reference | MIM:608555|HGNC:HGNC:7506|Ensembl:ENSG00000128654|HPRD:09777|Vega:OTTHUMG00000132514 |
Gene type | protein-coding |
Map location | 2 q31.1 |
Pascal p-value | 0.044 |
Sherlock p-value | 0.499 |
eGene | Myers' cis & trans 元 |
Support | G2Cdb.human_mitochondria |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs758989 | chr7 | 44203005 | MTX2 | 10651 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/MTX2_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
COX8A | 0.85 | 0.81 |
NDUFS8 | 0.85 | 0.82 |
MPG | 0.85 | 0.75 |
GPX4 | 0.85 | 0.81 |
C16orf13 | 0.84 | 0.82 |
FBXL15 | 0.84 | 0.82 |
C11orf59 | 0.84 | 0.76 |
MRPL55 | 0.84 | 0.81 |
ANKRD39 | 0.83 | 0.78 |
PSMG3 | 0.83 | 0.77 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
EIF5B | -0.42 | -0.54 |
RBM25 | -0.38 | -0.37 |
NSBP1 | -0.38 | -0.45 |
AF347015.18 | -0.38 | -0.29 |
SFRS12 | -0.37 | -0.35 |
AC010300.1 | -0.37 | -0.48 |
CCDC55 | -0.37 | -0.32 |
CD2AP | -0.36 | -0.29 |
Z83840.4 | -0.35 | -0.31 |
ZNF326 | -0.35 | -0.30 |
Section III. Gene Ontology annotation
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0006839 | mitochondrial transport | TAS | glutamate (GO term level: 6) | 10381257 |
GO:0015031 | protein transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005739 | mitochondrion | IEA | - | |
GO:0005741 | mitochondrial outer membrane | TAS | 10381257 | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME MITOCHONDRIAL PROTEIN IMPORT | 58 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP | 139 | 83 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
APPIERTO RESPONSE TO FENRETINIDE DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
WOOD EBV EBNA1 TARGETS UP | 110 | 71 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 5 | 126 | 78 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
WONG MITOCHONDRIA GENE MODULE | 217 | 122 | All SZGR 2.0 genes in this pathway |
阿塞维多甲基化在李VER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
HOLLEMAN DAUNORUBICIN ALL UP | 7 | 5 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-26 | 45 | 52 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.