Gene Page:MTX2

Summary?
GeneID 10651
Symbol MTX2
Synonyms -
Description metaxin 2
Reference MIM:608555|HGNC:HGNC:7506|Ensembl:ENSG00000128654|HPRD:09777|Vega:OTTHUMG00000132514
Gene type protein-coding
Map location 2 q31.1
Pascal p-value 0.044
Sherlock p-value 0.499
eGene Myers' cis & trans
元
Support G2Cdb.human_mitochondria

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs758989 chr7 44203005 MTX2 10651 0.18 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
COX8A 0.85 0.81
NDUFS8 0.85 0.82
MPG 0.85 0.75
GPX4 0.85 0.81
C16orf13 0.84 0.82
FBXL15 0.84 0.82
C11orf59 0.84 0.76
MRPL55 0.84 0.81
ANKRD39 0.83 0.78
PSMG3 0.83 0.77
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
EIF5B -0.42 -0.54
RBM25 -0.38 -0.37
NSBP1 -0.38 -0.45
AF347015.18 -0.38 -0.29
SFRS12 -0.37 -0.35
AC010300.1 -0.37 -0.48
CCDC55 -0.37 -0.32
CD2AP -0.36 -0.29
Z83840.4 -0.35 -0.31
ZNF326 -0.35 -0.30

Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006839 mitochondrial transport TAS glutamate (GO term level: 6) 10381257
GO:0015031 protein transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005739 mitochondrion IEA -
GO:0005741 mitochondrial outer membrane TAS 10381257
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME MITOCHONDRIAL PROTEIN IMPORT 58 24 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS 518 242 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP 139 83 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE DN 51 35 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS UP 110 71 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK 779 480 All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA 176 122 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 126 78 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP 388 234 All SZGR 2.0 genes in this pathway
WONG MITOCHONDRIA GENE MODULE 217 122 All SZGR 2.0 genes in this pathway
阿塞维多甲基化在李VER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
MOOTHA PGC 420 269 All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA 447 277 All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP 338 225 All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP 418 282 All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP 408 276 All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS 535 325 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP 756 494 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
HOLLEMAN DAUNORUBICIN ALL UP 7 5 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-26 45 52 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU