Gene Page:CSPG5

Summary?
GeneID 10675
Symbol CSPG5
Synonyms NGC
Description chondroitin sulfate proteoglycan 5
Reference MIM:606775|HGNC:HGNC:2467|Ensembl:ENSG00000114646|
Gene type protein-coding
Map location 3p21.3
Pascal p-value 0.208
Sherlock p-value 0.395
Fetal beta -1.242
DMG 1 (# studies)
Support CELL ADHESION AND TRANSSYNAPTIC SIGNALING

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search 系统的搜索in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg04289624 3 47620963 CSPG5 5.253E-4 0.487 0.048 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 12885772
GO:0005515 protein binding TAS 12885772
GO:0008083 growth factor activity TAS 12885772
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0050804 regulation of synaptic transmission IEA neuron, Synap (GO term level: 7) -
GO:0007399 nervous system development TAS neurite (GO term level: 5) 12885772
GO:0001558 regulation of cell growth IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
GO:0046907 intracellular transport TAS 12885772
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005794 Golgi apparatus IDA 12885772
GO:0005789 endoplasmic reticulum membrane IEA -
GO:0005624 membrane fraction TAS 9950058
GO:0005783 endoplasmic reticulum IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 9950058
GO:0030660 Golgi-associated vesicle membrane IDA 12885772

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KIM RESPONSE TO TSA AND DECITABINE UP 129 73 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184 125 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP 430 232 All SZGR 2.0 genes in this pathway
WANG HCP PROSTATE CANCER 111 69 All SZGR 2.0 genes in this pathway
GUENTHER GROWTH SPHERICAL VS ADHERENT UP 21 15 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION 88 68 All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 11Q23 DELETION 23 18 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP 105 73 All SZGR 2.0 genes in this pathway
SONG TARGETS OF IE86 CMV PROTEIN 60 42 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287 208 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR UP 148 96 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN 442 275 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP 259 159 All SZGR 2.0 genes in this pathway
NABA ECM附属 171 89 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-495 94 100 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU