Gene Page:CSPG5
Summary?
GeneID | 10675 |
Symbol | CSPG5 |
Synonyms | NGC |
Description | chondroitin sulfate proteoglycan 5 |
Reference | MIM:606775|HGNC:HGNC:2467|Ensembl:ENSG00000114646| |
Gene type | protein-coding |
Map location | 3p21.3 |
Pascal p-value | 0.208 |
Sherlock p-value | 0.395 |
Fetal beta | -1.242 |
DMG | 1 (# studies) |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | 系统的搜索in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04289624 | 3 | 47620963 | CSPG5 | 5.253E-4 | 0.487 | 0.048 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CSPG5_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 12885772 | |
GO:0005515 | protein binding | TAS | 12885772 | |
GO:0008083 | growth factor activity | TAS | 12885772 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0050804 | regulation of synaptic transmission | IEA | neuron, Synap (GO term level: 7) | - |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 12885772 |
GO:0001558 | regulation of cell growth | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0046907 | intracellular transport | TAS | 12885772 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | IDA | 12885772 | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005624 | membrane fraction | TAS | 9950058 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 9950058 | |
GO:0030660 | Golgi-associated vesicle membrane | IDA | 12885772 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KIM RESPONSE TO TSA AND DECITABINE UP | 129 | 73 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
GUENTHER GROWTH SPHERICAL VS ADHERENT UP | 21 | 15 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
HASLINGER B CLL WITH 11Q23 DELETION | 23 | 18 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
SONG TARGETS OF IE86 CMV PROTEIN | 60 | 42 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
NABA ECM附属 | 171 | 89 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-495 | 94 | 100 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.