Gene Page:CFL1
Summary?
| GeneID | 1072 |
| Symbol | CFL1 |
| Synonyms | CFL|HEL-S-15|cofilin |
| Description | cofilin 1 |
| Reference | MIM:601442|HGNC:HGNC:1874|Ensembl:ENSG00000172757|HPRD:03261| |
| Gene type | protein-coding |
| Map location | 11q13 |
| Pascal p-value | 0.169 |
| Sherlock p-value | 0.286 |
| Fetal beta | 0.239 |
| DMG | 2 (# studies) |
| Support | STRUCTURAL PLASTICITY G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0832 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Differentially methylated gene| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg04946535 | 11 | 65627070 | CFL1 | -0.025 | 0.25 | DMG:Nishioka_2013 | |
| cg04946535 | 11 | 65627070 | CFL1 | 1.05E-8 | -0.012 | 4.49E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DGKB | 0.71 | 0.60 |
| HTR4 | 0.68 | 0.54 |
| IL17RA | 0.67 | 0.55 |
| ANO3 | 0.67 | 0.52 |
| PDE7B | 0.66 | 0.62 |
| LOXHD1 | 0.66 | 0.54 |
| SCN4B | 0.65 | 0.51 |
| ST8SIA3 | 0.65 | 0.51 |
| PDE1B | 0.64 | 0.53 |
| LINGO3 | 0.64 | 0.52 |
| 十大negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| EMID1 | -0.35 | -0.51 |
| RPL12 | -0.35 | -0.53 |
| ALKBH2 | -0.35 | -0.44 |
| NR2C2AP | -0.34 | -0.41 |
| UBE2L6 | -0.34 | -0.44 |
| CCDC28B | -0.34 | -0.52 |
| RPL36 | -0.34 | -0.54 |
| TRNAU1AP | -0.34 | -0.38 |
| TRAF4 | -0.34 | -0.48 |
| RPL35 | -0.34 | -0.53 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003779 | actin binding | IEA | - | |
| GO:0005515 | protein binding | 新闻学会 | 12361576|16713569|17353931 |
|
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0001755 | neural crest cell migration | IEA | - | |
| GO:0000910 | cytokinesis | IEA | - | |
| GO:0001842 | neural fold formation | IEA | - | |
| GO:0030010 | establishment of cell polarity | IEA | - | |
| GO:0007266 | Rho protein signal transduction | TAS | 10436159 | |
| GO:0007015 | actin filament organization | IEA | - | |
| GO:0006928 | cell motion | IEA | - | |
| GO:0006916 | anti-apoptosis | TAS | 16130169 | |
| GO:0030836 | positive regulation of actin filament depolymerization | IEA | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005856 | cytoskeleton | IEA | - | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | TAS | 16130169 | |
| GO:0005737 | cytoplasm | TAS | 16130169 | |
| GO:0016363 | nuclear matrix | IEA | - | |
| GO:0030864 | cortical actin cytoskeleton | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ACTA1 | ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3 | 肌动蛋白α1,骨骼肌 | Affinity Capture-MS | BioGRID | 11950878 |
| ACTA1 | ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3 | 肌动蛋白α1,骨骼肌 | - | HPRD | 11707283 |
| ACTA2 | AAT6 | ACTSA | actin, alpha 2, smooth muscle, aorta | - | HPRD | 11707283 |
| ACTB | PS1TP5BP1 | 肌动蛋白,β | Two-hybrid | BioGRID | 16189514 |
| ACTC1 | ACTC | CMD1R | CMH11 | actin, alpha, cardiac muscle 1 | - | HPRD | 12207032 |
| ACTG1 | ACT | ACTG | DFNA20 | DFNA26 | actin, gamma 1 | Two-hybrid | BioGRID | 16189514 |
| ATP1A1 | MGC3285 | MGC51750 | ATPase, Na+/K+ transporting, alpha 1 polypeptide | - | HPRD | 11139403 |
| CAP1 | CAP | CAP1-PEN | CAP, adenylate cyclase-associated protein 1 (yeast) | - | HPRD,BioGRID | 11950878 |
| HSPH1 | DKFZp686M05240 | HSP105 | HSP105A | HSP105B | KIAA0201 | NY-CO-25 | heat shock 105kDa/110kDa protein 1 | Reconstituted Complex Two-hybrid |
BioGRID | 14733918 |
| LIMK1 | LIMK | LIM domain kinase 1 | - | HPRD | 9655398 |
| LIMK1 | LIMK | LIM domain kinase 1 | Biochemical Activity | BioGRID | 10436159|12963706 |
| LIMK2 | - | LIM domain kinase 2 | Affinity Capture-Western | BioGRID | 10436159 |
| MYCBP | AMY-1 | c-myc binding protein | Two-hybrid | BioGRID | 16169070 |
| ROCK1 | MGC131603 | MGC43611 | P160ROCK | PRO0435 | Rho-associated, coiled-coil containing protein kinase 1 | Affinity Capture-Western | BioGRID | 10436159 |
| SSH1 | FLJ38102 | KIAA1298 | SSH-1 | slingshot homolog 1 (Drosophila) | Unphosphorylated SSH-1L interacts with and dephosphorylates cofilin. | BIND | 15660133 |
| TAGLN | DKFZp686P11128 | SM22 | SMCC | TAGLN1 | WS3-10 | transgelin | Affinity Capture-MS | BioGRID | 17353931 |
| TPI1 | MGC88108 | TPI | triosephosphate isomerase 1 | - | HPRD,BioGRID | 12359716 |
| TXNDC17 | MGC14353 | TRP14 | TXNL5 | thioredoxin domain containing 17 | Affinity Capture-MS | BioGRID | 14607843 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CCR3 PATHWAY | 23 | 21 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RAC1 PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA RHO PATHWAY | 32 | 23 | All SZGR 2.0 genes in this pathway |
| SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
| SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
| SA FAS SIGNALING | 9 | 5 | All SZGR 2.0 genes in this pathway |
| SA G1 AND S PHASES | 15 | 10 | All SZGR 2.0 genes in this pathway |
| PID RHOA PATHWAY | 45 | 33 | All SZGR 2.0 genes in this pathway |
| PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
| PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
| PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 | 89 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PAK DEPENDENT AXON REPULSION | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| MEINHOLD OVARIAN CANCER LOW GRADE DN | 20 | 16 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| GNATENKO PLATELET SIGNATURE | 48 | 28 | All SZGR 2.0 genes in this pathway |
| WIELAND UP BY HBV INFECTION | 101 | 66 | All SZGR 2.0 genes in this pathway |
| NADLER OBESITY UP | 61 | 34 | All SZGR 2.0 genes in this pathway |
| HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE DN | 61 | 39 | All SZGR 2.0 genes in this pathway |
| HONMA DOCETAXEL RESISTANCE | 34 | 23 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
| 金所有DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 UP | 140 | 94 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-103/107 | 334 | 340 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-182 | 135 | 142 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-370 | 104 | 110 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-96 | 136 | 142 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.