Summary?
GeneID 10767
Symbol HBS1L
Synonyms EF-1a|ERFS|HBS1|HSPC276|eRF3c
Description HBS1 like translational GTPase
Reference MIM:612450|HGNC:HGNC:4834|Ensembl:ENSG00000112339|HPRD:06582|Vega:OTTHUMG00000015626
Gene type protein-coding
Map location 6q23.3
Pascal p-value 0.984
Sherlock p-value 0.96
Fetal beta -0.678
DMG 1 (# studies)
eGene Caudate basal ganglia
Hippocampus
Hypothalamus
Nucleus accumbens basal ganglia
Putamen basal ganglia
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg24665839 6 135375929 HBS1L 2.47E-9 -0.007 1.84E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4646871 chr6 135265616 HBS1L 10767 1.382E-5 cis
rs4472368 chr6 135274231 HBS1L 10767 9.267E-5 cis
rs4289677 chr6 135275484 HBS1L 10767 6.488E-4 cis
rs4896118 chr6 135276064 HBS1L 10767 6.755E-5 cis
rs1014021 chr6 135334599 HBS1L 10767 0.01 cis
rs6923765 chr6 135335175 HBS1L 10767 0.01 cis
rs4896128 chr6 135349755 HBS1L 10767 6.986E-5 cis
rs1590975 chr6 135352087 HBS1L 10767 0 cis
rs9321481 chr6 135352647 HBS1L 10767 0 cis
rs11754265 chr6 135356215 HBS1L 10767 0.01 cis
rs7741515 chr6 135374367 HBS1L 10767 0 cis
rs2150681 chr6 135375231 HBS1L 10767 0 cis
rs1547247 chr6 135390835 HBS1L 10767 0.05 cis
rs4646871 chr6 135265616 HBS1L 10767 0 trans
rs4472368 chr6 135274231 HBS1L 10767 0.01 trans
rs4289677 chr6 135275484 HBS1L 10767 0.05 trans
rs4896118 chr6 135276064 HBS1L 10767 0.01 trans
rs4896128 chr6 135349755 HBS1L 10767 0.01 trans
rs1590975 chr6 135352087 HBS1L 10767 0.19 trans
rs9321481 chr6 135352647 HBS1L 10767 0.14 trans
rs7741515 chr6 135374367 HBS1L 10767 0.14 trans
rs2150681 chr6 135375231 HBS1L 10767 0.11 trans
rs3817776 6 135256756 HBS1L ENSG00000112339.10 1.517E-8 0 167438 gtex_brain_putamen_basal
rs67422857 6 135259753 HBS1L ENSG00000112339.10 6.384E-9 0 164441 gtex_brain_putamen_basal
rs202230363 6 135259759 HBS1L ENSG00000112339.10 8.018E-9 0 164435 gtex_brain_putamen_basal
rs4646871 6 135265617 HBS1L ENSG00000112339.10 8.018E-12 0 158577 gtex_brain_putamen_basal
rs5012874 6 135267925 HBS1L ENSG00000112339.10 1.272E-6 0 156269 gtex_brain_putamen_basal
rs7749106 6 135268142 HBS1L ENSG00000112339.10 1.546E-9 0 156052 gtex_brain_putamen_basal
rs200182923 6 135268982 HBS1L ENSG00000112339.10 6.511E-9 0 155212 gtex_brain_putamen_basal
rs4646868 6 135271946 HBS1L ENSG00000112339.10 1.206E-11 0 152248 gtex_brain_putamen_basal
rs4646867 6 135272080 HBS1L ENSG00000112339.10 1.705E-6 0 152114 gtex_brain_putamen_basal
rs4267967 6 135272477 HBS1L ENSG00000112339.10 1.91E-12 0 151717 gtex_brain_putamen_basal
rs7771310 6 135272535 HBS1L ENSG00000112339.10 1.233E-6 0 151659 gtex_brain_putamen_basal
rs71006746 6 135273396 HBS1L ENSG00000112339.10 1.452E-6 0 150798 gtex_brain_putamen_basal
rs4472368 6 135274232 HBS1L ENSG00000112339.10 8.952E-11 0 149962 gtex_brain_putamen_basal
rs4289677 6 135275485 HBS1L ENSG00000112339.10 3.76E-6 0 148709 gtex_brain_putamen_basal
rs4440481 6 135276696 HBS1L ENSG00000112339.10 5.553E-12 0 147498 gtex_brain_putamen_basal
rs4520025 6 135278619 HBS1L ENSG00000112339.10 3.446E-6 0 145575 gtex_brain_putamen_basal
rs4451150 6 135279063 HBS1L ENSG00000112339.10 3.76E-6 0 145131 gtex_brain_putamen_basal
rs9376072 6 135280519 HBS1L ENSG00000112339.10 1.196E-11 0 143675 gtex_brain_putamen_basal
rs1135205 6 135281795 HBS1L ENSG00000112339.10 2.562E-11 0 142399 gtex_brain_putamen_basal
rs9389248 6 135282656 HBS1L ENSG00000112339.10 1.375E-11 0 141538 gtex_brain_putamen_basal
rs61738492 6 135282771 HBS1L ENSG00000112339.10 5.381E-7 0 141423 gtex_brain_putamen_basal
rs4475342 6 135283348 HBS1L ENSG00000112339.10 2.232E-11 0 140846 gtex_brain_putamen_basal
rs9399129 6 135285148 HBS1L ENSG00000112339.10 5.019E-12 0 139046 gtex_brain_putamen_basal
rs13199205 6 135286505 HBS1L ENSG00000112339.10 1.622E-11 0 137689 gtex_brain_putamen_basal
rs4895434 6 135293365 HBS1L ENSG00000112339.10 4.743E-10 0 130829 gtex_brain_putamen_basal
rs4896119 6 135293391 HBS1L ENSG00000112339.10 5.363E-12 0 130803 gtex_brain_putamen_basal
rs4895435 6 135293463 HBS1L ENSG00000112339.10 4.735E-10 0 130731 gtex_brain_putamen_basal
rs4896120 6 135293512 HBS1L ENSG00000112339.10 1.445E-10 0 130682 gtex_brain_putamen_basal
rs4896121 6 135293645 HBS1L ENSG00000112339.10 5.59E-11 0 130549 gtex_brain_putamen_basal
rs7755680 6 135294259 HBS1L ENSG00000112339.10 5.118E-12 0 129935 gtex_brain_putamen_basal
rs4895436 6 135295001 HBS1L ENSG00000112339.10 5.118E-12 0 129193 gtex_brain_putamen_basal
rs4896122 6 135295081 HBS1L ENSG00000112339.10 8.063E-12 0 129113 gtex_brain_putamen_basal
rs4896123 6 135295410 HBS1L ENSG00000112339.10 4.53E-10 0 128784 gtex_brain_putamen_basal
rs4407732 6 135296073 HBS1L ENSG00000112339.10 1.87E-11 0 128121 gtex_brain_putamen_basal
rs9376075 6 135296963 HBS1L ENSG00000112339.10 5.118E-12 0 127231 gtex_brain_putamen_basal
rs4273704 6 135297520 HBS1L ENSG00000112339.10 5.118E-12 0 126674 gtex_brain_putamen_basal
rs4637662 6 135298158 HBS1L ENSG00000112339.10 5.118E-12 0 126036 gtex_brain_putamen_basal
rs9376077 6 135299713 HBS1L ENSG00000112339.10 5.118E-12 0 124481 gtex_brain_putamen_basal
rs35123050 6 135302740 HBS1L ENSG00000112339.10 1.416E-10 0 121454 gtex_brain_putamen_basal
rs4376365 6 135307740 HBS1L ENSG00000112339.10 5.11E-12 0 116454 gtex_brain_putamen_basal
rs4445070 6 135309212 HBS1L ENSG00000112339.10 1.657E-11 0 114982 gtex_brain_putamen_basal
rs4388304 6 135309597 HBS1L ENSG00000112339.10 8.488E-12 0 114597 gtex_brain_putamen_basal
rs13218642 6 135309940 HBS1L ENSG00000112339.10 5.439E-11 0 114254 gtex_brain_putamen_basal
rs4451151 6 135310546 HBS1L ENSG00000112339.10 1.301E-11 0 113648 gtex_brain_putamen_basal
rs11154790 6 135312945 HBS1L ENSG00000112339.10 3.31E-12 0 111249 gtex_brain_putamen_basal
rs6925424 6 135313948 HBS1L ENSG00000112339.10 5.345E-11 0 110246 gtex_brain_putamen_basal
rs6902954 6 135313994 HBS1L ENSG00000112339.10 5.345E-11 0 110200 gtex_brain_putamen_basal
rs7741626 6 135314182 HBS1L ENSG00000112339.10 5.379E-12 0 110012 gtex_brain_putamen_basal
rs6909975 6 135315570 HBS1L ENSG00000112339.10 1.423E-10 0 108624 gtex_brain_putamen_basal
rs398085324 6 135316234 HBS1L ENSG00000112339.10 5.345E-11 0 107960 gtex_brain_putamen_basal
rs4895438 6 135317665 HBS1L ENSG00000112339.10 5.019E-12 0 106529 gtex_brain_putamen_basal
rs7773126 6 135318390 HBS1L ENSG00000112339.10 1.423E-10 0 105804 gtex_brain_putamen_basal
rs4895439 6 135318854 HBS1L ENSG00000112339.10 5.019E-12 0 105340 gtex_brain_putamen_basal
rs397802384 6 135319562 HBS1L ENSG00000112339.10 3.381E-12 0 104632 gtex_brain_putamen_basal
rs17638970 6 135320063 HBS1L ENSG00000112339.10 5.37E-11 0 104131 gtex_brain_putamen_basal
rs11754504 6 135321509 HBS1L ENSG00000112339.10 5.019E-12 0 102685 gtex_brain_putamen_basal
rs9402673 6 135322620 HBS1L ENSG00000112339.10 3.462E-10 0 101574 gtex_brain_putamen_basal
rs9688342 6 135323026 HBS1L ENSG00000112339.10 3.046E-10 0 101168 gtex_brain_putamen_basal
rs74279965 6 135323203 HBS1L ENSG00000112339.10 9.171E-10 0 100991 gtex_brain_putamen_basal
rs199731039 6 135324050 HBS1L ENSG00000112339.10 3.419E-11 0 100144 gtex_brain_putamen_basal
rs78074109 6 135324052 HBS1L ENSG00000112339.10 4.479E-11 0 100142 gtex_brain_putamen_basal
rs4559100 6 135324085 HBS1L ENSG00000112339.10 5.355E-11 0 100109 gtex_brain_putamen_basal
rs12527707 6 135324511 HBS1L ENSG00000112339.10 4.578E-11 0 99683 gtex_brain_putamen_basal
rs12527683 6 135324534 HBS1L ENSG00000112339.10 5.019E-12 0 99660 gtex_brain_putamen_basal
rs9389251 6 135325717 HBS1L ENSG00000112339.10 5.345E-11 0 98477 gtex_brain_putamen_basal
rs9402675 6 135325794 HBS1L ENSG00000112339.10 5.019E-12 0 98400 gtex_brain_putamen_basal
rs12526055 6 135325918 HBS1L ENSG00000112339.10 5.019E-12 0 98276 gtex_brain_putamen_basal
rs6929661 6 135328792 HBS1L ENSG00000112339.10 5.345E-11 0 95402 gtex_brain_putamen_basal
rs9389253 6 135329755 HBS1L ENSG00000112339.10 5.019E-12 0 94439 gtex_brain_putamen_basal
rs2327578 6 135329969 HBS1L ENSG00000112339.10 6.402E-11 0 94225 gtex_brain_putamen_basal
rs9389254 6 135330709 HBS1L ENSG00000112339.10 2.659E-11 0 93485 gtex_brain_putamen_basal
rs9389255 6 135330873 HBS1L ENSG00000112339.10 1.032E-9 0 93321 gtex_brain_putamen_basal
rs9389256 6 135331254 HBS1L ENSG00000112339.10 9.431E-12 0 92940 gtex_brain_putamen_basal
rs6910530 6 135332770 HBS1L ENSG00000112339.10 1.127E-8 0 91424 gtex_brain_putamen_basal
rs1014020 6 135334426 HBS1L ENSG00000112339.10 5.019E-12 0 89768 gtex_brain_putamen_basal
rs1014021 6 135334600 HBS1L ENSG00000112339.10 1.625 e 11 0 89594 gtex_brain_putamen_basal
rs1041481 6 135335063 HBS1L ENSG00000112339.10 5.019E-12 0 89131 gtex_brain_putamen_basal
rs6923765 6 135335176 HBS1L ENSG00000112339.10 5.019E-12 0 89018 gtex_brain_putamen_basal
rs6923827 6 135335382 HBS1L ENSG00000112339.10 3.251E-10 0 88812 gtex_brain_putamen_basal
rs6902438 6 135336587 HBS1L ENSG00000112339.10 5.019E-12 0 87607 gtex_brain_putamen_basal
rs6902888 6 135336857 HBS1L ENSG00000112339.10 5.351E-11 0 87337 gtex_brain_putamen_basal
rs9385713 6 135337039 HBS1L ENSG00000112339.10 1.113E-8 0 87155 gtex_brain_putamen_basal
rs6908681 6 135337733 HBS1L ENSG00000112339.10 5.019E-12 0 86461 gtex_brain_putamen_basal
rs386408702 6 135338053 HBS1L ENSG00000112339.10 4.135E-12 0 86141 gtex_brain_putamen_basal
rs200605623 6 135339133 HBS1L ENSG00000112339.10 3.26E-11 0 85061 gtex_brain_putamen_basal
rs3756799 6 135341011 HBS1L ENSG00000112339.10 5.292E-12 0 83183 gtex_brain_putamen_basal
rs59329760 6 135342437 HBS1L ENSG00000112339.10 5.345E-11 0 81757 gtex_brain_putamen_basal
rs4896125 6 135342569 HBS1L ENSG00000112339.10 5.345E-11 0 81625 gtex_brain_putamen_basal
rs4896126 6 135342786 HBS1L ENSG00000112339.10 4.975E-12 0 81408 gtex_brain_putamen_basal
rs978036 6 135342903 HBS1L ENSG00000112339.10 5.019E-12 0 81291 gtex_brain_putamen_basal
rs949547 6 135343499 HBS1L ENSG00000112339.10 6.8E-11 0 80695 gtex_brain_putamen_basal
rs1023179 6 135343829 HBS1L ENSG00000112339.10 2.931E-12 0 80365 gtex_brain_putamen_basal
rs9389257 6 135344311 HBS1L ENSG00000112339.10 5.019E-12 0 79883 gtex_brain_putamen_basal
rs9376082 6 135346389 HBS1L ENSG00000112339.10 5.019E-12 0 77805 gtex_brain_putamen_basal
rs397701688 6 135346639 HBS1L ENSG00000112339.10 3.239E-10 0 77555 gtex_brain_putamen_basal
rs2150680 6 135347131 HBS1L ENSG00000112339.10 5.345E-11 0 77063 gtex_brain_putamen_basal
rs11756988 6 135347595 HBS1L ENSG00000112339.10 5.345E-11 0 76599 gtex_brain_putamen_basal
rs11754783 6 135347661 HBS1L ENSG00000112339.10 5.345E-11 0 76533 gtex_brain_putamen_basal
rs952674 6 135349157 HBS1L ENSG00000112339.10 7.47E-12 0 75037 gtex_brain_putamen_basal
rs12661423 6 135349570 HBS1L ENSG00000112339.10 5.024E-11 0 74624 gtex_brain_putamen_basal
rs987690 6 135350379 HBS1L ENSG00000112339.10 5.019E-12 0 73815 gtex_brain_putamen_basal
rs397716890 6 135350485 HBS1L ENSG00000112339.10 5.882E-12 0 73709 gtex_brain_putamen_basal
rs7750300 6 135350950 HBS1L ENSG00000112339.10 5.019E-12 0 73244 gtex_brain_putamen_basal
rs1590975 6 135352088 HBS1L ENSG00000112339.10 2.543E-11 0 72106 gtex_brain_putamen_basal
rs6569988 6 135352303 HBS1L ENSG00000112339.10 3.251E-10 0 71891 gtex_brain_putamen_basal
rs6919862 6 135352443 HBS1L ENSG00000112339.10 5.345E-11 0 71751 gtex_brain_putamen_basal
rs9321481 6 135352648 HBS1L ENSG00000112339.10 5.019E-12 0 71546 gtex_brain_putamen_basal
rs10872427 6 135353452 HBS1L ENSG00000112339.10 5.341E-11 0 70742 gtex_brain_putamen_basal
rs7766189 6 135353851 HBS1L ENSG00000112339.10 5.345E-11 0 70343 gtex_brain_putamen_basal
rs74279966 6 135354072 HBS1L ENSG00000112339.10 4.147E-11 0 70122 gtex_brain_putamen_basal
rs4134030 6 135354094 HBS1L ENSG00000112339.10 4.836E-9 0 70100 gtex_brain_putamen_basal
rs4896130 6 135355118 HBS1L ENSG00000112339.10 4.449E-10 0 69076 gtex_brain_putamen_basal
rs9402676 6 135355507 HBS1L ENSG00000112339.10 5.345E-11 0 68687 gtex_brain_putamen_basal
rs7748274 6 135355723 HBS1L ENSG00000112339.10 1.625 e 11 0 68471 gtex_brain_putamen_basal
rs11754265 6 135356216 HBS1L ENSG00000112339.10 3.251E-10 0 67978 gtex_brain_putamen_basal
rs7742542 6 135358567 HBS1L ENSG00000112339.10 5.369E-11 0 65627 gtex_brain_putamen_basal
rs61459569 6 135359508 HBS1L ENSG00000112339.10 8.351E-11 0 64686 gtex_brain_putamen_basal
rs1854865 6 135360300 HBS1L ENSG00000112339.10 1.557E-11 0 63894 gtex_brain_putamen_basal
rs9389258 6 135361140 HBS1L ENSG00000112339.10 5.349E-11 0 63054 gtex_brain_putamen_basal
rs7763836 6 135362378 HBS1L ENSG00000112339.10 2.131平台以及 0 61816 gtex_brain_putamen_basal
rs2327580 6 135364417 HBS1L ENSG00000112339.10 5.345E-11 0 59777 gtex_brain_putamen_basal
rs6569990 6 135365818 HBS1L ENSG00000112339.10 1.094E-10 0 58376 gtex_brain_putamen_basal
rs13191501 6 135366880 HBS1L ENSG00000112339.10 2.913E-11 0 57314 gtex_brain_putamen_basal
rs398085326 6 135367389 HBS1L ENSG00000112339.10 5.225E-11 0 56805 gtex_brain_putamen_basal
rs6908512 6 135367757 HBS1L ENSG00000112339.10 3.326E-11 0 56437 gtex_brain_putamen_basal
rs13209789 6 135367916 HBS1L ENSG00000112339.10 5.345E-11 0 56278 gtex_brain_putamen_basal
rs9399135 6 135368314 HBS1L ENSG00000112339.10 4.449E-10 0 55880 gtex_brain_putamen_basal
rs6915770 6 135369214 HBS1L ENSG00000112339.10 5.345E-11 0 54980 gtex_brain_putamen_basal
rs34546690 6 135369709 HBS1L ENSG00000112339.10 2.131平台以及 0 54485 gtex_brain_putamen_basal
rs11755229 6 135369913 HBS1L ENSG00000112339.10 3.326E-11 0 54281 gtex_brain_putamen_basal
rs11759999 6 135370495 HBS1L ENSG00000112339.10 2.677E-11 0 53699 gtex_brain_putamen_basal
rs11760000 6 135370496 HBS1L ENSG00000112339.10 4.229E-11 0 53698 gtex_brain_putamen_basal
rs9402677 6 135370708 HBS1L ENSG00000112339.10 2.427E-11 0 53486 gtex_brain_putamen_basal
rs9389261 6 135371148 HBS1L ENSG00000112339.10 3.407E-11 0 53046 gtex_brain_putamen_basal
rs9376085 6 135371224 HBS1L ENSG00000112339.10 2.352E-11 0 52970 gtex_brain_putamen_basal
rs9376086 6 135371329 HBS1L ENSG00000112339.10 5.503E-11 0 52865 gtex_brain_putamen_basal
rs9402678 6 135372103 HBS1L ENSG00000112339.10 5.503E-11 0 52091 gtex_brain_putamen_basal
rs9376087 6 135372231 HBS1L ENSG00000112339.10 3.75E-9 0 51963 gtex_brain_putamen_basal
rs1041480 6 135373076 HBS1L ENSG00000112339.10 5.503E-11 0 51118 gtex_brain_putamen_basal
rs9373122 6 135373534 HBS1L ENSG00000112339.10 2.178E-10 0 50660 gtex_brain_putamen_basal
rs7741515 6 135374368 HBS1L ENSG00000112339.10 5.503E-11 0 49826 gtex_brain_putamen_basal
rs2150681 6 135375232 HBS1L ENSG00000112339.10 1.925E-10 0 48962 gtex_brain_putamen_basal
rs2297338 6 135375762 HBS1L ENSG00000112339.10 2.639E-11 0 48432 gtex_brain_putamen_basal
rs2297339 6 135375991 HBS1L ENSG00000112339.10 1.031E-11 0 48203 gtex_brain_putamen_basal
rs2297340 6 135376058 HBS1L ENSG00000112339.10 5.503E-11 0 48136 gtex_brain_putamen_basal
rs28384512 6 135376232 HBS1L ENSG00000112339.10 6.769E-11 0 47962 gtex_brain_putamen_basal
rs41294852 6 135376379 HBS1L ENSG00000112339.10 1.921E-10 0 47815 gtex_brain_putamen_basal
rs9389262 6 135376409 HBS1L ENSG00000112339.10 2.634E-11 0 47785 gtex_brain_putamen_basal
rs2183709 6 135377091 HBS1L ENSG00000112339.10 2.629E-11 0 47103 gtex_brain_putamen_basal
rs4142299 6 135377186 HBS1L ENSG00000112339.10 2.629E-11 0 47008 gtex_brain_putamen_basal
rs2150682 6 135377632 HBS1L ENSG00000112339.10 5.484E-11 0 46562 gtex_brain_putamen_basal
rs397796924 6 135378253 HBS1L ENSG00000112339.10 2.074E-10 0 45941 gtex_brain_putamen_basal
rs200769099 6 135383222 HBS1L ENSG00000112339.10 7.508E-7 0 40972 gtex_brain_putamen_basal
rs11757577 6 135391465 HBS1L ENSG00000112339.10 5.865E-9 0 32729 gtex_brain_putamen_basal
rs4896131 6 135392100 HBS1L ENSG00000112339.10 7.274E-9 0 32094 gtex_brain_putamen_basal
rs9402681 6 135397301 HBS1L ENSG00000112339.10 1.5E-6 0 26893 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003746 translation elongation factor activity IEA -
GO:0003924 GTPase activity IEA -
GO:0005525 GTP binding IEA -
GO:0005525 GTP binding TAS 9872408
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006412 translation TAS 9872408
GO:0007165 signal transduction TAS 9872408

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HOLLMANN APOPTOSIS VIA CD40 UP 201 125 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP 408 247 All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE UP 152 90 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN 320 184 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS DN 186 114 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456 228 All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP 214 134 All SZGR 2.0 genes in this pathway
DARWICHE皮肤肿瘤促进剂 142 96 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP 162 104 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP 147 101 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP 146 104 All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP 77 60 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196 137 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238 145 All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE DN 50 36 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6 456 285 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 UP 87 52 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-200bc/429 148 154 1A hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU