Gene Page:ARID5A

Summary?
GeneID 10865
Symbol ARID5A
Synonyms MRF-1|MRF1|RP11-363D14
Description 5 at富集作用域
Reference MIM:611583|HGNC:HGNC:17361|Ensembl:ENSG00000196843|HPRD:12481|Vega:OTTHUMG00000155229
Gene type protein-coding
Map location 2q11.2
Pascal p-value 0.03
Fetal beta 0.676
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_I Genome scan meta-analysis Psr: 0.0004

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg16388829 2 97202323 ARID5A 7.99E-8 -0.011 1.87E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
某fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DLX6 0.79 0.72
GSX1 0.79 0.29
BEST3 0.77 0.27
AC009041.1 0.77 0.61
AC011270.1 0.77 0.19
AC009041.3 0.76 0.61
AC018470.3 0.76 0.64
MADCAM1 0.76 0.45
SP9 0.76 0.65
MUC1 0.75 0.22
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.24 -0.25
MT-CO2 -0.24 -0.24
AF347015.15 -0.23 -0.25
AF347015.2 -0.23 -0.23
AF347015.8 -0.23 -0.24
MT-CYB -0.22 -0.24
AF347015.27 -0.22 -0.21
AF347015.33 -0.21 -0.19
AF347015.21 -0.21 -0.24
MT-ATP8 -0.21 -0.26

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IEA -
GO:0005730 nucleolus IDA 18029348

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HUTTMANN B CLL POOR SURVIVAL UP 276 187 All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL UP 121 72 All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN 36 24 All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP 151 100 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP 64 46 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MF UP 47 27 All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT UP 78 48 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN 409 268 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP 210 124 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION C 69 49 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-324-3p 149 155 m8 hsa-miR-324-3p CCACUGCCCCAGGUGCUGCUGG