Gene Page:TMED1

Summary?
GeneID 11018
Symbol TMED1
Synonyms IL1RL1LG|Il1rl1l|Tp24|p24g1
Description transmembrane p24 trafficking protein 1
Reference MIM:605395|HGNC:HGNC:17291|HPRD:05653|
Gene type protein-coding
Map location 19p13.2
Pascal p-value 0.032
Sherlock p-value 0.188
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs11927689 chr3 20557187 TMED1 11018 0.09 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MFHAS1 0.93 0.89
TIAM2 0.92 0.88
RP1-21O18.1 0.91 0.89
MED13L 0.91 0.89
AFF3 0.91 0.90
EML1 0.91 0.87
GRIK3 0.91 0.85
BACH2 0.90 0.84
CELSR3 0.90 0.88
SEZ6 0.90 0.87
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SERPINB6 -0.65 -0.72
HSD17B14 -0.59 -0.74
AF347015.31 -0.58 -0.79
BDH2 -0.58 -0.74
C5orf53 -0.57 -0.67
S100B -0.57 -0.77
MGST2 -0.57 -0.70
AIFM3 -0.57 -0.69
S100A16 -0.57 -0.76
MT-CO2 -0.57 -0.79

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005102 receptor binding TAS Neurotransmitter (GO term level: 4) 8621446
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007267 cell-cell signaling TAS 8621446
GO:0007165 signal transduction TAS 8621446
GO:0006810 transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU SOX4 TARGETS UP 137 94 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP 283 177 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN 292 189 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP 181 106 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225 124 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 DN 180 116 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 289 295 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 288 295 1A,m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC