Gene Page:TMED1
Summary?
GeneID | 11018 |
Symbol | TMED1 |
Synonyms | IL1RL1LG|Il1rl1l|Tp24|p24g1 |
Description | transmembrane p24 trafficking protein 1 |
Reference | MIM:605395|HGNC:HGNC:17291|HPRD:05653| |
Gene type | protein-coding |
Map location | 19p13.2 |
Pascal p-value | 0.032 |
Sherlock p-value | 0.188 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs11927689 | chr3 | 20557187 | TMED1 | 11018 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TMED1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MFHAS1 | 0.93 | 0.89 |
TIAM2 | 0.92 | 0.88 |
RP1-21O18.1 | 0.91 | 0.89 |
MED13L | 0.91 | 0.89 |
AFF3 | 0.91 | 0.90 |
EML1 | 0.91 | 0.87 |
GRIK3 | 0.91 | 0.85 |
BACH2 | 0.90 | 0.84 |
CELSR3 | 0.90 | 0.88 |
SEZ6 | 0.90 | 0.87 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SERPINB6 | -0.65 | -0.72 |
HSD17B14 | -0.59 | -0.74 |
AF347015.31 | -0.58 | -0.79 |
BDH2 | -0.58 | -0.74 |
C5orf53 | -0.57 | -0.67 |
S100B | -0.57 | -0.77 |
MGST2 | -0.57 | -0.70 |
AIFM3 | -0.57 | -0.69 |
S100A16 | -0.57 | -0.76 |
MT-CO2 | -0.57 | -0.79 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 8621446 |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007267 | cell-cell signaling | TAS | 8621446 | |
GO:0007165 | signal transduction | TAS | 8621446 | |
GO:0006810 | transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE UP | 181 | 106 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 289 | 295 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 288 | 295 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.