Gene Page:STMN2

Summary?
GeneID 11075
Symbol STMN2
Synonyms SCG10|SCGN10
Description stathmin 2
Reference MIM:600621|HGNC:HGNC:10577|Ensembl:ENSG00000104435|HPRD:09003|Vega:OTTHUMG00000164610
Gene type protein-coding
Map location 8q21.13
Pascal p-value 0.065
Sherlock p-value 0.906
Fetal beta 0.336
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs12123144 chr1 76550208 STMN2 11075 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MRPS22 0.88 0.87
COMMD8 0.87 0.87
RP4-604K5.1 0.87 0.85
CCDC104 0.86 0.85
ATP5F1 0.85 0.81
COMMD10 0.85 0.84
CHMP5 0.84 0.80
COPS4 0.84 0.84
PSMC6 0.84 0.83
TXNDC9 0.83 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TENC1 -0.48 -0.53
MTSS1L -0.48 -0.51
MICALL2 -0.46 -0.51
FAM38A -0.46 -0.47
DOCK6 -0.46 -0.47
AF347015.18 -0.45 -0.29
C10orf108 -0.45 -0.51
AC020763.2 -0.44 -0.48
C9orf131 -0.44 -0.50
AC010618.2 -0.44 -0.50

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 16189514
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030182 neuron differentiation NAS neuron (GO term level: 8) -
GO:0007242 intracellular signaling cascade IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0042995 cell projection IEA axon (GO term level: 4) -
GO:0030426 growth cone IEA axon, dendrite (GO term level: 5) -
GO:0005624 membrane fraction NAS -
GO:0005625 soluble fraction NAS -
GO:0005737 cytoplasm IEA -
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF UP 115 78 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN 164 111 All SZGR 2.0 genes in this pathway
COWLING MYCN TARGETS 43 27 All SZGR 2.0 genes in this pathway
ROPERO HDAC2 TARGETS 114 71 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 8Q12 Q22 AMPLICON 132 82 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS 185 114 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN 86 62 All SZGR 2.0 genes in this pathway
MCCLUNG DELTA FOSB TARGETS 2WK 48 36 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP 268 157 All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR UP 36 24 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435 289 All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS DN 46 26 All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE 56 34 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
DASU IL6 SIGNALING UP 59 44 All SZGR 2.0 genes in this pathway
金所有DISORDERS OLIGODENDROCYTE NUMBER CORR UP 756 494 All SZGR 2.0 genes in this pathway
金所有DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN 315 215 All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN 148 88 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP 163 111 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN 244 157 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN 418 245 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-34b 43 49 1A hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-369-3p 50 56 1A hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 50 57 1A,m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-485-3p 85 91 m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU