Gene Page:KAT7

Summary?
GeneID 11143
Symbol KAT7
Synonyms HBO1|HBOA|MYST2|ZC2HC7
Description lysine acetyltransferase 7
Reference MIM:609880|HGNC:HGNC:17016|Ensembl:ENSG00000136504|HPRD:07135|Vega:OTTHUMG00000161770
Gene type protein-coding
Map location 17q21.32
Pascal p-value 0.024
Sherlock p-value 0.168

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL类型
rs3217906 chr12 4405803 MYST2 11143 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 转录因子的活动 IEA -
GO:0005515 protein binding 新闻学会 10930412|15383276|16169070
GO:0004406 H3/H4 histone acetyltransferase activity TAS 10438470
GO:0016740 transferase activity IEA -
GO:0008270 zinc ion binding IEA -
GO:0008415 acyltransferase activity IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent TAS 10438470
GO:0006350 transcription IEA -
GO:0006260 DNA replication TAS 10438470
GO:0016568 chromatin modification IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus TAS 10438470

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AR AIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFM androgen receptor - HPRD,BioGRID 10930412
ATN1 B37 | D12S755E | DRPLA | NOD atrophin 1 Two-hybrid BioGRID 16169070
C15orf29 FLJ22557 | MGC117356 chromosome 15 open reading frame 29 Two-hybrid BioGRID 16169070
C9orf82 FLJ13657 | RP11-337A23.1 chromosome 9 open reading frame 82 Two-hybrid BioGRID 16169070
CALCOCO2 MGC17318 | NDP52 calcium binding and coiled-coil domain 2 Two-hybrid BioGRID 16189514
CBX8 HPC3 |生物| RC1 chromobox homolog 8 (Pc class homolog, Drosophila) Two-hybrid BioGRID 16169070
CEP70 BITE | FLJ13036 centrosomal protein 70kDa Two-hybrid BioGRID 16189514
DDX11 CHL1 | CHLR1 | KRG2 | MGC133249 | MGC9335 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) Two-hybrid BioGRID 16169070
DVL3 KIAA0208 dishevelled, dsh homolog 3 (Drosophila) Two-hybrid BioGRID 16189514
HOOK2 FLJ26218 | HK2 hook homolog 2 (Drosophila) Two-hybrid BioGRID 16189514
KCTD13 FKSG86 | PDIP1 | POLDIP1 potassium channel tetramerisation domain containing 13 Two-hybrid BioGRID 16189514
ORC1L HSORC1 | ORC1 | PARC1 origin recognition complex, subunit 1-like (yeast) - HPRD,BioGRID 10438470
PACSIN1 KIAA1379 | SDPI protein kinase C and casein kinase substrate in neurons 1 Two-hybrid BioGRID 16169070
POLB MGC125976 polymerase (DNA directed), beta Two-hybrid BioGRID 16169070
PPID CYP-40 | CYPD | MGC33096 peptidylprolyl isomerase D Two-hybrid BioGRID 16169070
RGL2 HKE1.5 | KE1.5 | RAB2L ral guanine nucleotide dissociation stimulator-like 2 Two-hybrid BioGRID 16169070
RP4-691N24.1 FLJ11792 | KIAA0980 | NLP | dJ691N24.1 ninein-like Two-hybrid BioGRID 16189514
RPS10 MGC88819 ribosomal protein S10 Two-hybrid BioGRID 16169070
SAT1 DC21 | KFSD | SAT | SSAT | SSAT-1 spermidine/spermine N1-acetyltransferase 1 Two-hybrid BioGRID 16169070
SEPT5 CDCREL | CDCREL-1 | CDCREL1 | H5 | PNUTL1 septin 5 Two-hybrid BioGRID 16169070
SNAPIN SNAPAP SNAP-associated protein Two-hybrid BioGRID 16169070
VIM FLJ36605 vimentin Two-hybrid BioGRID 16169070|16189514
WDR33 FLJ11294 | WDC146 WD repeat domain 33 Two-hybrid BioGRID 16169070
ZBTB8 BOZF1 | FLJ90065 | MGC17919 zinc finger and BTB domain containing 8 Two-hybrid BioGRID 16189514
ZNF165 LD65 | ZSCAN7 zinc finger protein 165 Two-hybrid BioGRID 16189514


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID AR TF PATHWAY 53 38 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A UP 191 128 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP 109 69 All SZGR 2.0 genes in this pathway
BENPORATH ES 1 379 235 All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES 147 87 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON 335 181 All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO CURCUMIN SULINDAC 7 19 10 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3 160 103 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463 262 All SZGR 2.0 genes in this pathway
MUELLER PLURINET 299 189 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP 298 174 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882 506 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 275 282 1A,m8 hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-124/506 1349 1355 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-128 1387 1393 m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-132/212 1452 1458 1A hsa-miR-212SZ UAACAGUCUCCAGUCACGGCC
hsa-miR-132brain UAACAGUCUACAGCCAUGGUCG
miR-134 289 295 m8 hsa-miR-134brain UGUGACUGGUUGACCAGAGGG
miR-142-3p 1373 1379 m8 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
miR-144 276 282 1A hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-148/152 249 255 1A hsa-miR-148a UCAGUGCACUACAGAACUUUGU
hsa-miR-152brain UCAGUGCAUGACAGAACUUGGG
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
miR-149 17 23 m8 hsa-miR-149brain UCUGGCUCCGUGUCUUCACUCC
miR-335 79 85 m8 hsa-miR-335brain UCAAGAGCAAUAACGAAAAAUGU
miR-491 1530 1537 1A,m8 hsa-miR-491brain AGUGGGGAACCCUUCCAUGAGGA
miR-539 1212 1218 m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU