Gene Page:WBP4
Summary?
| GeneID | 11193 |
| Symbol | WBP4 |
| Synonyms | FBP21 |
| Description | WW domain binding protein 4 |
| Reference | MIM: 604981|HGNC:HGNC:12739|Ensembl:ENSG00000120688|HPRD:16086|Vega:OTTHUMG00000016784 |
| Gene type | protein-coding |
| Map location | 13q14.11 |
| Pascal p-value | 0.383 |
| Sherlock p-value | 0.237 |
| Fetal beta | -1.069 |
| DMG | 2 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0333 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Differentially methylated gene| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06096994 | 13 | 41635664 | WBP4 | 4.895E-4 | -0.212 | 0.047 | DMG:Wockner_2014 |
| cg11311296 | 13 | 41635997 | WBP4 | 9.15E-10 | -0.031 | 1.11E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7514423 | chr1 | 29778112 | WBP4 | 11193 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0006397 | mRNA processing | IEA | - | |
| GO:0008380 | RNA splicing | IEA | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005681 | spliceosome | IEA | - | |
| GO:0016607 | nuclear speck | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| BERNARD PPAPDC1B TARGETS UP | 40 | 20 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-23 | 124 | 130 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC | ||||
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-369-3p | 209 | 215 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-376c | 259 | 265 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.