Gene Page:NXPH4

Summary?
GeneID 11247
Symbol NXPH4
Synonyms NPH4
Description neurexophilin 4
Reference MIM:604637|HGNC:HGNC:8078|Ensembl:ENSG00000182379|HPRD:06866|Vega:OTTHUMG00000171241
Gene type protein-coding
Map location 12q13.3
Pascal p-value 0.013
Fetal beta 0.676
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg11468462 12 57610686 NXPH4 1.31E-6 -0.425 0.007 DMG:Wockner_2014
cg12502577 12 57615581 NXPH4 1.507E-4 -0.37 0.032 DMG:Wockner_2014
cg05835276 12 57619364 NXPH4 4.433E-4 -0.435 0.045 DMG:Wockner_2014
cg05441768 12 57619401 NXPH4 4.711E-4 -0.603 0.046 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1507047 chr16 50932778 NXPH4 11247 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003674 molecular_function ND 9570794
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway NAS Neurotransmitter (GO term level: 8) 9570794
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region NAS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN 634 384 All SZGR 2.0 genes in this pathway
SAMOLS TARGETS OF KHSV MIRNAS DN 62 35 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP 633 376 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
PETRETTO BLOOD PRESSURE UP 12 8 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR 532 309 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142 103 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-375 676 682 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA