Gene Page:CYGB

Summary?
GeneID 114757
Symbol CYGB
Synonyms HGB|STAP
Description cytoglobin
Reference MIM:608759|HGNC:HGNC:16505|Ensembl:ENSG00000161544|HPRD:06479|Vega:OTTHUMG00000180289
Gene type protein-coding
Map location 17q25.1
Pascal p-value 0.188
Sherlock p-value 0.262
Fetal beta -0.911
DMG 1 (# studies)
eGene Myers' cis & trans
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg02057796 17 74530987 CYGB 1.844E-4 0.346 0.034 DMG:Wockner_2014
cg21301440 17 74534550 CYGB 3.698E-4 -0.268 0.043 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs254364 chr16 65984075 CYGB 114757 0.2 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004601 peroxidase activity ISS 11320098
GO:0005506 iron ion binding IEA -
GO:0005344 oxygen transporter activity NAS 11919282
GO:0019825 oxygen binding IEA -
GO:0020037 heme binding IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006810 transport IEA -
GO:0006979 response to oxidative stress ISS 11320098
去:0015671 oxygen transport NAS 11919282
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0043025 cell soma IEA axon, dendrite (GO term level: 4) -
GO:0043005 neuron projection IEA neuron, axon, neurite, dendrite (GO term level: 5) -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP 285 181 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 137 97 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP 170 107 All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN 354 216 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536 296 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE DN 99 74 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-409-5p 1177 1183 1A hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCA
miR-96 85 91 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC