Gene Page:TMEM200A

Summary?
GeneID 114801
Symbol TMEM200A
Synonyms KIAA1913|TTMA|TTMC
Description transmembrane protein 200A
Reference HGNC:HGNC:21075|Ensembl:ENSG00000164484|HPRD:13901|Vega:OTTHUMG00000015557
Gene type protein-coding
Map location 6q23.1
Pascal p-value 7.602E-4
Sherlock p-value 0.033
Fetal beta -0.712
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs12302525 chr12 89726424 TMEM200A 114801 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component 去term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SENGUPTA NASOPHARYNGEAL CARCINOMA UP 294 178 All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP 306 188 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP 194 122 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP 175 108 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP 222 139 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 120 81 All SZGR 2.0 genes in this pathway
GENTLES LEUKEMIC STEM CELL UP 29 15 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-338 1050 1056 1A hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
miR-9 1073 1079 1A hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA