Gene Page:SLAMF6

Summary?
GeneID 114836
Symbol SLAMF6
Synonyms CD352|KALI|KALIb|Ly108|NTB-A|NTBA|SF2000
Description 大满贯家庭成员6
Reference MIM:606446|HGNC:HGNC:21392|Ensembl:ENSG00000162739|HPRD:05920|Vega:OTTHUMG00000022729
Gene type protein-coding
Map location 1q23.2
Fetal beta -0.098
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 2
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg18920397 1 160765805 SLAMF6 2.61E-6 -3.81 DMG:vanEijk_2014
cg11721194 1 160709239 SLAMF6 1.59E-5 -7.243 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ZHOU INFLAMMATORY RESPONSE LIVE DN 384 220 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456 228 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196 137 All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245 148 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
CHEN LIVER METABOLISM QTL CIS 93 40 All SZGR 2.0 genes in this pathway
ONO AML1 TARGETS DN 41 25 All SZGR 2.0 genes in this pathway
ONO FOXP3 TARGETS DN 42 23 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 850 857 1A,m8 hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-370 357 364 1A,m8 hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG