Gene Page:ADCYAP1

概括?
基因 116
Symbol ADCYAP1
Synonyms PACAP
Description adenylate cyclase activating polypeptide 1 (pituitary)
Reference MIM:102980|HGNC：HGNC：241|Ensembl:ENSG00000141433|HPRD:02369|Vega：Otthumg00000131479
Gene type protein-coding
Map location 18p11
Pascal p-value 0.717
Sherlock p-value 0.106
Fetal beta -2.728

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 1 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DTX4 0.97 0.96
SRGAP2 0.95 0.97
RALGPS1 0.95 0.96
TRIO 0.95 0.97
DYRK2 0.94 0.96
ATXN7L1 0.94 0.96
FAM123B 0.94 0.95
CDK5R1 0.94 0.96
KDM2B 0.94 0.96
CLASP1 0.93 0.96
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HEPN1 -0.74 -0.82
AIFM3 -0.73 -0.82
TSC22D4 -0.73 -0.84
SERPINB6 -0.73 -0.80
S100B -0.72 -0.88
HSD17B14 -0.72 -0.84
AF347015.31 -0.72 -0.91
FXYD1 -0.71 -0.89
HLA-F -0.71 -0.79
ALDOC -0.71 -0.75

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005184 neuropeptide hormone activity TAS axon, Synap, Brain, Neurotransmitter (GO term level: 6) 2302217
GO:0005057 receptor signaling protein activity IEA -
GO:0005179 hormone activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007190 activation of adenylate cyclase activity 经验 16805430
GO:0007190 activation of adenylate cyclase activity TAS 1730060
GO:0007169 跨膜受体蛋白酪氨酸激酶团体naling pathway 经验 16939974
GO:0007267 cell-cell signaling TAS 2302217
GO:0007565 female pregnancy TAS 10698193
GO:0045786 negative regulation of cell cycle IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005625 soluble fraction TAS 10698193

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME SIGNALLING BY NGF 217 167 All SZGR 2.0 genes in this pathway
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE 137 105 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GLUCAGON TYPE LIGAND RECEPTORS 33 22 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS 121 82 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP 81 40 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP 157 91 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP 194 122 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS D UP 38 23 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN 169 112 All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP 87 67 All SZGR 2.0 genes in this pathway
MCCLUNG DELTA FOSB TARGETS 2WK 48 36 All SZGR 2.0 genes in this pathway
MA PITUITARY FETAL VS ADULT UP 29 21 All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN 98 67 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP 198 132 All SZGR 2.0 genes in this pathway
Bandres对Carmustin没有MGMT 48小时DN的响应 32 25 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN 161 105 All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS DN 108 64 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED 80 50 All SZGR 2.0 genes in this pathway
LOPEZ EPITHELIOID MESOTHELIOMA 17 11 All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3 41 30 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP 163 111 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
mir-133 200 206 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-135 121 127 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b Uauggcuuuucauuccuaugug
miR-362 401 407 1A hsa-miR-362 AAUCCUUGGAACCUAGGUGUGAGU