Gene Page:FOXP4

Summary?
GeneID 116113
Symbol FOXP4
Synonyms hFKHLA
Description forkhead box P4
Reference MIM:608924|HGNC:HGNC:20842|Ensembl:ENSG00000137166|HPRD:10600|Vega:OTTHUMG00000014679
Gene type protein-coding
Map location 6p21.1
Pascal p-value 0.021
Fetal beta -0.004
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 3
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 3
GSMA_I Genome scan meta-analysis Psr: 0.033
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04433

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01244432 6 41514307 FOXP4 1.514E-4 -0.242 0.032 DMG:Wockner_2014
cg02446366 6 41514112 FOXP4 5.04E-4 -0.281 0.047 DMG:Wockner_2014
cg03442064 6 41515050 FOXP4 1.89E-8 -0.012 6.68E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391 222 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411 249 All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN 409 268 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER UP 38 26 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C UP 47 29 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 DN 92 60 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 474 480 1A hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-129-5p 1015 1021 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-133 1376 1382 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-138 285 292 1A,m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-27 474 481 1A,m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-299-3p 1564 1571 1A,m8 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
miR-299-5p 1131 1137 1A hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
miR-30-5p 1140 1146 1A hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-370 294 300 m8 hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG
miR-450 1015 1021 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-9 990 997 1A,m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA