Gene Page:GABPB2

Summary?
GeneID 126626
Symbol GABPB2
Synonyms -
Description GA binding protein transcription factor beta subunit 2
Reference HGNC:HGNC:28441|Ensembl:ENSG00000143458|HPRD: 14536|Vega:OTTHUMG00000012193
Gene type protein-coding
Map location 1q21.3
Sherlock p-value 0.148
Fetal beta 0.719
DMG 1 (# studies)
eGene Cerebellar Hemisphere

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg16105380 1 151042876 GABPB2 9.86E-8 0.009 2.19E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 转录 IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PYEON HPV POSITIVE TUMORS UP 98 47 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER 80 52 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
CHEN NEUROBLASTOMA COPY NUMBER GAINS 50 35 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL 293 160 All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN 271 175 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP 139 95 All SZGR 2.0 genes in this pathway
SWEET KRAS ONCOGENIC SIGNATURE 89 56 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS INTERFERON DN 52 30 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN 374 217 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP 279 155 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-133 214 220 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA