Gene Page:CNP
Summary?
| GeneID | 1267 |
| Symbol | CNP |
| Synonyms | CNP1 |
| Description | 2',3'-cyclic nucleotide 3' phosphodiesterase |
| Reference | MIM:123830|HGNC:HGNC:2158|Ensembl:ENSG00000173786|HPRD:00448|Vega:OTTHUMG00000133502 |
| Gene type | protein-coding |
| Map location | 17q21 |
| Pascal p-value | 0.955 |
| Fetal beta | -0.866 |
| eGene | Myers' cis & trans |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.human_TAP-PSD-95-CORE CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
eQTL annotation| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7830259 | chr8 | 14087643 | CNP | 1267 | 0.04 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004113 | 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity | TAS | 8392017 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0007409 | axonogenesis | IEA | neuron, axon, neurite (GO term level: 12) | - |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 1322358 |
| GO:0016070 | RNA metabolic process | IEA | - | |
| GO:0008344 | adult locomotory behavior | IEA | - | |
| GO:0009214 | cyclic nucleotide catabolic process | IEA | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005615 | extracellular space | IDA | 12379507 | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005624 | membrane fraction | IEA | - | |
| GO:0005737 | cytoplasm | IDA | 12379507 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0042470 | melanosome | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| TONG INTERACT WITH PTTG1 | 57 | 32 | All SZGR 2.0 genes in this pathway |
| LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
| LEE AGING CEREBELLUM DN | 86 | 66 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR UP | 71 | 48 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON UP | 77 | 47 | All SZGR 2.0 genes in this pathway |
| LEIN OLIGODENDROCYTE MARKERS | 74 | 53 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL UP | 146 | 75 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-141/200a | 1403 | 1409 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-338 | 3738 | 3745 | 1A,m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-378 | 224 | 230 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-544 | 1425 | 1431 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.