Gene Page:ACVR1C

Summary?
GeneID 130399
Symbol ACVR1C
Synonyms ACVRLK7|ALK7
Description activin A receptor type 1C
Reference MIM:608981|HGNC:HGNC:18123|Ensembl:ENSG00000123612|HPRD:10608|Vega:OTTHUMG00000131964
Gene type protein-coding
Map location 2q24.1
Pascal p-value 0.1
Fetal beta -1.983
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg05010623 2 158485762 ACVR1C 4.307E-4 -0.593 0.045 DMG:Wockner_2014
cg18638253 2 158485309 ACVR1C 2.56E-8 -0.009 8.22E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0000287 magnesium ion binding IEA -
GO:0005024 transforming growth factor beta receptor activity IEA -
GO:0004872 receptor activity IEA -
GO:0005524 ATP binding IC 12063393
GO:0004674 protein serine/threonine kinase activity IEA -
GO:0016740 transferase activity IEA -
GO:0016361 activin receptor activity, type I IDA 12063393
GO:0030145 manganese ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IC 12063393
GO:0042981 regulation of apoptosis IDA 15531507
GO:0030154 cell differentiation IDA 15531507
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0048179 activin receptor complex IDA 15531507

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG TGF BETA SIGNALING PATHWAY 86 64 All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NODAL 18 11 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN 196 131 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 90 97 1A,m8 hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-26 320 327 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU