Gene Page:MAP3K8
Summary?
GeneID | 1326 |
Symbol | MAP3K8 |
Synonyms | AURA2|COT|EST|ESTF|MEKK8|TPL2|Tpl-2|c-COT |
Description | mitogen-activated protein kinase kinase kinase 8 |
Reference | MIM:191195|HGNC:HGNC:6860|Ensembl:ENSG00000107968|HPRD:01863|Vega:OTTHUMG00000017889 |
Gene type | protein-coding |
Map location | 10p11.23 |
Pascal p-value | 0.88 |
Fetal beta | 0.216 |
DMG | 1 (# studies) |
Gene in Data Sources
基因集名称 | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | 基因族群me-wide Association Study | GWAS | |
DMG:Jaffe_2016 | 基因族群me-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0333 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04081651 | 10 | 30722660 | MAP3K8 | 3.2E-10 | 0。016 | 7.03E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/MAP3K8_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 15169888 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004672 | protein kinase activity | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | TAS | 8226782 | |
GO:0004709 | MAP kinase kinase kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | TAS | 2072910 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | TAS | 8226782 | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | - | HPRD,BioGRID | 12138205 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | - | HPRD,BioGRID | 10072079 |
KSR2 | FLJ25965 | kinase suppressor of ras 2 | Affinity Capture-Western | BioGRID | 12975377 |
MAP2K1 | MAPKK1 | MEK1 | MKK1 | PRKMK1 | mitogen-activated protein kinase kinase 1 | Biochemical Activity | BioGRID | 8631303 |
MAP2K4 | JNKK | JNKK1 | MAPKK4 | MEK4 | MKK4 | PRKMK4 | SEK1 | SERK1 | mitogen-activated protein kinase kinase 4 | - | HPRD,BioGRID | 8631303 |
MAP3K14 | FTDCR1B | HS | HSNIK | NIK | mitogen-activated protein kinase kinase kinase 14 | - | HPRD,BioGRID | 10072079 |
NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | - | HPRD,BioGRID | 9950430 |
NFKB2 | LYT-10 | LYT10 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) | Affinity Capture-MS | BioGRID | 14743216 |
REL | C-Rel | v-rel reticuloendotheliosis viral oncogene homolog (avian) | Affinity Capture-MS | BioGRID | 14743216 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | Affinity Capture-MS | BioGRID | 14743216 |
TNIP2 | ABIN-2 | ABIN2 | FLIP1 | KLIP | MGC4289 | TNFAIP3 interacting protein 2 | - | HPRD,BioGRID | 14743216|15169888 |
TRAF2 | MGC:45012 | TRAP | TRAP3 | TNF receptor-associated factor 2 | - | HPRD,BioGRID | 11932422 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG TOLL LIKE RECEPTOR SIGNALING PATHWAY | 102 | 88 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
BIOCARTA MAPK PATHWAY | 87 | 68 | All SZGR 2.0 genes in this pathway |
ST ERK1 ERK2 MAPK PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
PID TCR PATHWAY | 66 | 51 | All SZGR 2.0 genes in this pathway |
PID CD8 TCR PATHWAY | 53 | 42 | All SZGR 2.0 genes in this pathway |
PID NFAT 3PATHWAY | 54 | 47 | All SZGR 2.0 genes in this pathway |
PID TCR RAS PATHWAY | 14 | 14 | All SZGR 2.0 genes in this pathway |
PID TCR JNK PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME CD28 CO STIMULATION | 32 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME COSTIMULATION BY THE CD28 FAMILY | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME CD28 DEPENDENT PI3K AKT SIGNALING | 22 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ILS | 107 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME IL1 SIGNALING | 39 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE UP | 152 | 90 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY UP | 78 | 41 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
ODONNELL TARGETS OF MYC AND TFRC UP | 83 | 50 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
RASHI NFKB1 TARGETS | 19 | 18 | All SZGR 2.0 genes in this pathway |
SCHEIDEREIT IKK INTERACTING PROTEINS | 58 | 45 | All SZGR 2.0 genes in this pathway |
SHI SPARC TARGETS DN | 13 | 8 | All SZGR 2.0 genes in this pathway |
THEODOROU乳腺肿瘤发生 | 31 | 24 | All SZGR 2.0 genes in this pathway |
AMIT SERUM RESPONSE 60 MCF10A | 57 | 42 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
MORI MATURE B LYMPHOCYTE UP | 90 | 62 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C4 | 18 | 12 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P4 | 100 | 62 | All SZGR 2.0 genes in this pathway |
GAVIN IL2 RESPONSIVE FOXP3 TARGETS UP | 19 | 12 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS UP | 26 | 16 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
ENGELMANN CANCER PROGENITORS UP | 48 | 31 | All SZGR 2.0 genes in this pathway |
GRADE METASTASIS DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
BREDEMEYER RAG SIGNALING VIA ATM NOT VIA NFKB UP | 49 | 32 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE UP | 212 | 128 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
UZONYI RESPONSE TO LEUKOTRIENE AND THROMBIN | 37 | 26 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 | 68 | 50 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION | 128 | 81 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-140 | 680 | 687 | 1A,m8 | hsa - mir - 140brain | AGUGGUUUUACCCUAUGGUAG |
miR-146 | 199 | 205 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-17-5p/20/93.mr/106/519.d | 286 | 292 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-299-3p | 683 | 689 | 1A | hsa-miR-299-3p | UAUGUGGGAUGGUAAACCGCUU |
miR-299-5p | 678 | 685 | 1A,m8 | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-370 | 567 | 573 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-539 | 205 | 212 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.