Gene Page:SGCZ

Summary?
GeneID 137868
Symbol SGCZ
Synonyms ZSG1
Description sarcoglycan zeta
Reference MIM:608113|HGNC:HGNC:14075|Ensembl:ENSG00000185053|HPRD:12165|Vega:OTTHUMG00000090827
Gene type protein-coding
Map location 8p22
Fetal beta -0.229

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.031

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去后m Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
Biological process 去后m Evidence Neuro keywords PubMed ID
去:0007010 cytoskeleton organization IEA -
Cellular component 去后m Evidence Neuro keywords PubMed ID
GO:0005856 cytoskeleton IEA -
GO:0005737 cytoplasm IEA -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0016012 sarcoglycan complex IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
MAYBURD RESPONSE TO L663536 UP 29 18 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN 314 188 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 268 274 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-155 485 491 m8 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG
miR-204/211 250 256 m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-218 289 295 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-539 9 15 m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU