Gene Page:ATF6B
Summary?
GeneID | 1388 |
Symbol | ATF6B |
Synonyms | CREB-RP|CREBL1|G13 |
Description | activating transcription factor 6 beta |
Reference | MIM:600984|HGNC:HGNC:2349|Ensembl:ENSG00000213676|HPRD:02992|Vega:OTTHUMG00000031296 |
Gene type | protein-coding |
Map location | 6p21.3 |
Pascal p-value | 1E-12 |
Sherlock p-value | 0.007 |
Fetal beta | -0.427 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/ATF6B_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
LRRC24 | 0.91 | 0.91 |
COMTD1 | 0.89 | 0.89 |
GNB2 | 0.89 | 0.91 |
C19orf22 | 0.89 | 0.92 |
FBL | 0.88 | 0.92 |
NFKBIE | 0.88 | 0.88 |
LRFN4 | 0.88 | 0.92 |
HTRA2 | 0.87 | 0.87 |
RTN2 | 0.87 | 0.88 |
AC009133.1 | 0.87 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.68 | -0.75 |
AF347015.33 | -0.67 | -0.75 |
AF347015.8 | -0.66 | -0.75 |
MT-CO2 | -0.66 | -0.72 |
MT-CYB | -0.66 | -0.74 |
AF347015.31 | -0.65 | -0.72 |
AF347015.15 | -0.65 | -0.74 |
AF347015.26 | -0.64 | -0.75 |
AF347015.2 | -0.64 | -0.73 |
MT-ATP8 | -0.59 | -0.76 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 8586413 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
GO:0046983 | protein dimerization activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | TAS | 8586413 | |
GO:0006986 | response to unfolded protein | IEA | - | |
GO:0007165 | signal transduction | TAS | 8586413 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005622 | intracellular | IDA | 8870652 | |
GO:0005634 | nucleus | TAS | 8586413 | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER UP | 96 | 57 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
BOGNI TREATMENT RELATED MYELOID LEUKEMIA UP | 30 | 19 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
击倒卡路里限制肌肉DN | 87 | 59 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
SU PLACENTA | 30 | 18 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP | 83 | 63 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-93.hd/291-3p/294/295/302/372/373/520 | 128 | 135 | 1A,m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.