Gene Page:SYT9
Summary?
GeneID | 143425 |
Symbol | SYT9 |
Synonyms | - |
Description | synaptotagmin 9 |
Reference | MIM:613528|HGNC:HGNC:19265|Ensembl:ENSG00000170743|HPRD:11618|Vega:OTTHUMG00000165499 |
Gene type | protein-coding |
Map location | 11p15.4 |
Pascal p-value | 0.168 |
TADA p-value | 0.001 |
Fetal beta | -0.946 |
eGene | 元 |
Support | EXOCYTOSIS |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
SYT9 | chr11 | 7334755 | NM_175733 | p.D209fs | frameshift INS | NA | NA | Schizophrenia | DNM:McCarthy_2014 | ||
SYT9 | chr11 | 7439282 | C | T | NM_175733 | . | silent | Schizophrenia | DNM:Gulsuner_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SYT9_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005215 | transporter activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006810 | transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
DN CHEBOTAEV GR目标 | 120 | 73 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-196 | 465 | 471 | m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-29 | 429 | 435 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-544 | 1782 | 1788 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
miR-9 | 1213 | 1219 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.