Gene Page:PRIMA1
Summary?
GeneID | 145270 |
Symbol | PRIMA1 |
Synonyms | PRIMA |
Description | proline rich membrane anchor 1 |
Reference | MIM:613851|HGNC:HGNC:18319|Ensembl:ENSG00000175785|HPRD:17907|Vega:OTTHUMG00000141313 |
Gene type | protein-coding |
Map location | 14q32.12 |
Pascal p-value | 0.056 |
Fetal beta | 0.572 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06918804 | 14 | 94254816 | PRIMA1 | 2.36E-9 | -0.018 | 1.77E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16869851 | chr4 | 20690056 | PRIMA1 | 145270 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PRIMA1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0042135 | neurotransmitter catabolic process | IEA | neuron, axon, Synap, Neurotransmitter (GO term level: 9) | - |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-181 | 2887 | 2893 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-369-3p | 2756 | 2762 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 2756 | 2762 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-410 | 2758 | 2764 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-96 | 867 | 874 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.