Gene Page:PRIMA1

Summary?
GeneID 145270
Symbol PRIMA1
Synonyms PRIMA
Description proline rich membrane anchor 1
Reference MIM:613851|HGNC:HGNC:18319|Ensembl:ENSG00000175785|HPRD:17907|Vega:OTTHUMG00000141313
Gene type protein-coding
Map location 14q32.12
Pascal p-value 0.056
Fetal beta 0.572
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06918804 14 94254816 PRIMA1 2.36E-9 -0.018 1.77E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16869851 chr4 20690056 PRIMA1 145270 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0042135 neurotransmitter catabolic process IEA neuron, axon, Synap, Neurotransmitter (GO term level: 9) -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LIU PROSTATE CANCER DN 481 290 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN 367 220 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-181 2887 2893 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-369-3p 2756 2762 1A hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 2756 2762 m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-410 2758 2764 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-96 867 874 1A,m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC