Gene Page:ADRB1
Summary?
GeneID | 153 |
Symbol | ADRB1 |
Synonyms | ADRB1R|B1AR|BETA1AR|RHR |
Description | adrenoceptor beta 1 |
Reference | MIM:109630|HGNC:HGNC:285|Ensembl:ENSG00000043591|HPRD:00181|Vega:OTTHUMG00000019079 |
Gene type | protein-coding |
Map location | 10q25.3 |
Pascal p-value | 0.952 |
Fetal beta | -1.304 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0018 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17028652 | 10 | 115805442 | ADRB1 | 3.49E-8 | -0.022 | 1.03E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/ADRB1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BAP1 | 0.90 | 0.87 |
BRSK1 | 0.89 | 0.85 |
SBF1 | 0.88 | 0.88 |
SEPT5 | 0.88 | 0.86 |
RANGAP1 | 0.88 | 0.87 |
AGAP3 | 0.88 | 0.85 |
SCYL1 | 0.88 | 0.84 |
RAB11FIP3 | 0.88 | 0.87 |
KATNB1 | 0.88 | 0.84 |
GIT1 | 0.87 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.72 | -0.54 |
MT-CO2 | -0.65 | -0.48 |
AF347015.8 | -0.64 | -0.47 |
AF347015.31 | -0.64 | -0.49 |
AP002478.3 | -0.63 | -0.56 |
NOSTRIN | -0.63 | -0.49 |
AF347015.18 | -0.62 | -0.44 |
GNG11 | -0.62 | -0.54 |
AL139819.3 | -0.62 | -0.56 |
MT-CYB | -0.61 | -0.45 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 16316992 | |
GO:0004940 | beta1-adrenergic receptor activity | IEA | - | |
GO:0004940 | beta1-adrenergic receptor activity | TAS | 10212248 | |
GO:0004935 | adrenoceptor activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0001996 | positive regulation of heart rate by epinephrine-norepinephrine | IEA | - | |
GO:0001997 | positive regulation of the force of heart contraction by epinephrine-norepinephrine | IEA | - | |
GO:0002024 | diet induced thermogenesis | IEA | - | |
GO:0002025 | vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure | IEA | - | |
GO:0007190 | activation of adenylate cyclase activity | TAS | 10212248 | |
GO:0007189 | G-protein signaling, adenylate cyclase activating pathway | IEA | - | |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0009409 | response to cold | IEA | - | |
GO:0040015 | negative regulation of multicellular organism growth | IEA | - | |
GO:0042596 | fear response | IEA | - | |
GO:0050873 | brown fat cell differentiation | IEA | - | |
GO:0031649 | heat generation | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005624 | membrane fraction | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | TAS | 10212248 | |
GO:0005887 | integral to plasma membrane | TAS | 10212248 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
KEGG GAP JUNCTION | 90 | 68 | All SZGR 2.0 genes in this pathway |
KEGG DILATED CARDIOMYOPATHY | 92 | 68 | All SZGR 2.0 genes in this pathway |
ST MYOCYTE AD PATHWAY | 27 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME AMINE LIGAND BINDING RECEPTORS | 38 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP | 175 | 108 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES与H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 UP | 45 | 29 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 VS CD2 UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE DN | 88 | 42 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 704 | 711 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-101 | 1124 | 1131 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-141/200a | 943 | 950 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-144 | 1125 | 1131 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-19 | 980 | 986 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA | ||||
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA | ||||
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-25/32/92/363/367 | 1313 | 1320 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-30-5p | 58 | 64 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-329 | 1228 | 1234 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-369-3p | 1142 | 1148 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 1142 | 1149 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.