Gene Page:DENND2C

Summary?
GeneID 163259
Symbol DENND2C
Synonyms dJ1156J9.1
Description DENN domain containing 2C
Reference HGNC:HGNC:24748|HPRD:13425|
Gene type protein-coding
Map location 1p13.2
Pascal p-value 0.039
eGene 小脑

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN 176 104 All SZGR 2.0 genes in this pathway
《图片报》极品致癌签名 261 166 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578 341 All SZGR 2.0 genes in this pathway
SHAFFER IRF4 MULTIPLE MYELOMA PROGRAM 36 25 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN 213 127 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP 504 321 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271 165 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462 273 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 227 149 All SZGR 2.0 genes in this pathway
BOSCO EPITHELIAL DIFFERENTIATION MODULE 69 31 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-96 39 46 1A,m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC