SZGR2 - Beplay体育中心

Summary?

GeneID	1647
Symbol	GADD45A
Synonyms	DDIT1\|GADD45
Description	growth arrest and DNA damage inducible alpha
Reference	MIM:126335\|HGNC:HGNC:4095\|Ensembl:ENSG00000116717\|HPRD:00528\|Vega:OTTHUMG00000009374
Gene type	protein-coding
Map location	1p31.2
Pascal p-value	0.01
Sherlock p-value	0.483
Fetal beta	-0.509
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02692

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs2820477	chr1	68708633	GADD45A	1647	0.04	cis
rs258563	chr5	136269271	GADD45A	1647	0.19	trans
rs735485	chr8	3706731	GADD45A	1647	0.19	trans
rs11833888	chr12	59350152	GADD45A	1647	0.07	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CNOT1	0.97	0.97
PRPF8	0.96	0.97
VPRBP	0.96	0.97
SEC24C	0.96	0.98
KPNB1	0.96	0.97
SART3	0.96	0.97
SIN3A	0.96	0.96
CKAP5	0.95	0.97
GLE1	0.95	0.96
LSG1	0.95	0.97

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.81	-0.90
MT-CO2	-0.79	-0.90
AF347015.27	-0.78	-0.88
FXYD1	-0.78	-0.88
AF347015.33	-0.77	-0.86
AF347015.8	-0.76	-0.88
MT-CYB	-0.76	-0.86
IFI27	-0.76	-0.86
AF347015.21	-0.75	-0.92
HIGD1B	-0.75	-0.86

Section III. Gene Ontology annotation

Molecular function	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0000079	regulation of cyclin-dependent protein kinase activity	TAS		10747892
GO:0006469	negative regulation of protein kinase activity	IEA		-
GO:0006281	DNA repair	TAS		7973727
GO:0007049	细胞周期	IEA		-
GO:0007050	细胞周期arrest	TAS		10747892
GO:0007098	centrosome cycle	IEA		-
GO:0006915	apoptosis	TAS		10828065
GO:0051726	regulation of cell cycle	IEA		-
Cellular component	去的术语	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		7798274

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CCNB1	CCNB	cyclin B1	Cyclin B1 interacts with Gadd45a. This interaction was modeled on a demonstrated interaction between human Cyclin B1 and Gadd45a from an unspecified species.	BIND	12124778
CCNB1	CCNB	cyclin B1	Reconstituted Complex	BioGRID	10362260
CDC2	CDC28A \| CDK1 \| DKFZp686L20222 \| MGC111195	cell division cycle 2, G1 to S and G2 to M	Cdk1 interacts with Gadd45a. This interaction was modeled on a demonstrated interaction between human Cdk1 and Gadd45a from an unspecified species.	BIND	12124778
CDC2	CDC28A \| CDK1 \| DKFZp686L20222 \| MGC111195	cell division cycle 2, G1 to S and G2 to M	-	HPRD,BioGRID	10973963
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	-	HPRD	7478594\|11498536
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Affinity Capture-Western Reconstituted Complex	BioGRID	10912791\|10973963
DCTN2	DCTN50 \| DYNAMITIN \| RBP50	dynactin 2 (p50)	Two-hybrid	BioGRID	16189514
EGR1	AT225 \| G0S30 \| KROX-24 \| NGFI-A \| TIS8 \| ZIF-268 \| ZNF225	early growth response 1	Egr-1 interacts with Gadd45a promoter.	BIND	15616591
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	Affinity Capture-Western	BioGRID	10872826
GADD45A	DDIT1 \| GADD45	growth arrest and DNA-damage-inducible, alpha	Affinity Capture-Western Reconstituted Complex	BioGRID	11498536
GADD45B	DKFZp566B133 \| GADD45BETA \| MYD118	growth arrest and DNA-damage-inducible, beta	-	HPRD,BioGRID	11498536
GADD45G	CR6 \| DDIT2 \| GADD45gamma \| GRP17	growth arrest and DNA-damage-inducible, gamma	-	HPRD,BioGRID	11498536
GADD45GIP1	CKBBP2 \| CRIF1 \| MGC4667 \| MGC4758 \| PLINP-1 \| PRG6 \| Plinp1	growth arrest and DNA-damage-inducible, gamma interacting protein 1	-	HPRD,BioGRID	12716909
GADD45GIP1	CKBBP2 \| CRIF1 \| MGC4667 \| MGC4758 \| PLINP-1 \| PRG6 \| Plinp1	growth arrest and DNA-damage-inducible, gamma interacting protein 1	CRIF1 interacts with Gadd45alpha.	BIND	12716909
HIST4H4	H4/p \| MGC24116	集群组蛋白H4	-	HPRD	10022855\|11498536
MAP3K4	FLJ42439 \| KIAA0213 \| MAPKKK4 \| MEKK4 \| MTK1 \| PRO0412	mitogen-activated protein kinase kinase kinase 4	-	HPRD,BioGRID	9827804\|11498536
NPM1	B23 \| MGC104254 \| NPM	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	-	HPRD	15644315
PCNA	MGC8367	proliferating cell nuclear antigen	PCNA interacts with Gadd45.	BIND	9705499
PCNA	MGC8367	proliferating cell nuclear antigen	PCNA interacts with Gadd45.	BIND	9178907
PCNA	MGC8367	proliferating cell nuclear antigen	Gadd45a interacts with PCNA. This interaction was modeled on a demonstrated interaction between Gadd45a from an unspecified species and human PCNA.	BIND	12124778
PCNA	MGC8367	proliferating cell nuclear antigen	-	HPRD,BioGRID	7973727\|10828065
PCNA	MGC8367	proliferating cell nuclear antigen	GADD45 interacts with PCNA.	BIND	10828065
PPARA	MGC2237 \| MGC2452 \| NR1C1 \| PPAR \| hPPAR	peroxisome proliferator-activated receptor alpha	-	HPRD	10872826
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	Affinity Capture-Western	BioGRID	10872826
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	-	HPRD,BioGRID	10872826

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY	69	45	All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA G2 PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA P53HYPOXIA PATHWAY	23	21	All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY	16	13	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
ST P38 MAPK PATHWAY	37	28	All SZGR 2.0 genes in this pathway
ST JNK MAPK PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID P38 MKK3 6PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID FOXO PATHWAY	49	43	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY	31	20	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY	54	40	All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN	136	86	All SZGR 2.0 genes in this pathway
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP	59	38	All SZGR 2.0 genes in this pathway
ZERBINI RESPONSE TO SULINDAC UP	9	6	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP	64	37	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
NOJIMA SFRP2 TARGETS UP	31	23	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN	275	168	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL DN	86	59	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
SCIBETTA KDM5B TARGETS UP	19	12	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
PACHER TARGETS OF IGF1 AND IGF2 UP	35	27	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
LAU APOPTOSIS CDKN2A UP	55	40	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP	58	39	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF UP	215	137	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F DN	33	24	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA FOREVER UP	19	13	All SZGR 2.0 genes in this pathway
CAIRO PML TARGETS BOUND BY MYC DN	14	12	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
KERLEY RESPONSE TO CISPLATIN UP	44	30	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP	126	78	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP	214	144	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 1	45	27	All SZGR 2.0 genes in this pathway
AIYAR COBRA1 TARGETS UP	39	25	All SZGR 2.0 genes in this pathway
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 UP	64	45	All SZGR 2.0 genes in this pathway
WANG METHYLATED IN BREAST CANCER	35	25	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
HUI MAPK14 TARGETS UP	21	11	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 ONLY UP	33	18	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS UP	127	79	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 120 HELA	69	47	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 MCF10A	39	24	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A	65	44	All SZGR 2.0 genes in this pathway
考夫曼DNA修复GENES	230	137	All SZGR 2.0 genes in this pathway
UEDA CENTRAL CLOCK	88	62	All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS UP	58	40	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS DN	46	26	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN	162	102	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP	182	119	All SZGR 2.0 genes in this pathway
MENSE HYPOXIA UP	98	71	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL	293	160	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 4HR	54	36	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C6	39	27	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 6HR UP	37	31	All SZGR 2.0 genes in this pathway
INGA TP53 TARGETS	17	13	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C2	18	15	All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS UP	21	16	All SZGR 2.0 genes in this pathway
ZHANG PROLIFERATING VS QUIESCENT	51	41	All SZGR 2.0 genes in this pathway
GAJATE RESPONSE TO TRABECTEDIN UP	67	45	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP	244	151	All SZGR 2.0 genes in this pathway
DELLA RESPONSE TO TSA AND BUTYRATE	21	17	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN	261	183	All SZGR 2.0 genes in this pathway
LEE AGING NEOCORTEX UP	89	59	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE UP	25	13	All SZGR 2.0 genes in this pathway
SARTIPY BLUNTED BY INSULIN RESISTANCE DN	18	14	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 0HR	63	48	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP	123	75	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
VARELA ZMPSTE24 TARGETS UP	40	30	All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE UP	45	33	All SZGR 2.0 genes in this pathway
KYNG RESPONSE TO H2O2	71	42	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G2	30	18	All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS UP	49	40	All SZGR 2.0 genes in this pathway
KRIGE AMINO ACID DEPRIVATION	29	20	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS DN	39	30	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION	88	65	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN	195	135	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
GALI TP53 TARGETS APOPTOTIC UP	8	7	All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS UP	102	64	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
PODAR RESPONSE TO ADAPHOSTIN UP	147	98	All SZGR 2.0 genes in this pathway
CUI GLUCOSE DEPRIVATION	60	44	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
HELLEBREKERS SILENCED DURING TUMOR ANGIOGENESIS	80	56	All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B	53	36	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
SWEET KRAS ONCOGENIC SIGNATURE	89	56	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP	91	63	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 DN	40	26	All SZGR 2.0 genes in this pathway
COULOUARN颞TGFB1 SIGNATURE DN	138	99	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL UP	47	38	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL DN	76	51	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 3	15	7	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G28	20	11	All SZGR 2.0 genes in this pathway
ONGUSAHA BRCA1 TARGETS UP	13	11	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M	216	124	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
SUBTIL PROGESTIN TARGETS	36	25	All SZGR 2.0 genes in this pathway
ZHU SKIL TARGETS UP	20	14	All SZGR 2.0 genes in this pathway
DELPUECH FOXO3 TARGETS DN	41	27	All SZGR 2.0 genes in this pathway
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2	57	39	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP	169	105	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR UP	53	33	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP	110	68	All SZGR 2.0 genes in this pathway
WARTERS IR RESPONSE 5GY	47	23	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	31	37	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	32	39	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-362	92	98	m8	hsa-miR-362	AAUCCUUGGAACCUAGGUGUGAGU
miR-369-3p	457	463	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	457	464	1A,m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.

Gene Page:GADD45A