Gene Page:ARX

Summary?
GeneID 170302
Symbol ARX
Synonyms CT121|EIEE1|ISSX|MRX29|MRX32|MRX33|MRX36|MRX38|MRX43|MRX54|MRX76|MRX87|MRXS1|PRTS
Description aristaless related homeobox
Reference MIM:300382|HGNC:HGNC:18060|Ensembl:ENSG00000004848|HPRD:02307|Vega:OTTHUMG00000021275
Gene type protein-coding
Map location Xp21.3
Fetal beta 0.327
eGene Myers' cis & trans
Support Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 7

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs319490 chr1 118281893 ARX 170302 0.08 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0021759 globus pallidus development IEA Brain (GO term level: 10) -
GO:0007411 axon guidance IEA axon (GO term level: 13) -
GO:0001764 neuron migration IEA neuron (GO term level: 8) -
GO:0030900 forebrain development IEA Brain (GO term level: 8) -
GO:0021853 cerebral cortex GABAergic interneuron migration IEA neuron, GABA (GO term level: 14) -
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0021800 cerebral cortex tangential migration IEA Glial (GO term level: 13) -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
GO:0042127 regulation of cell proliferation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LU TUMOR VASCULATURE DN 13 6 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY DN 138 70 All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP 214 134 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR 43 35 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN 110 78 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A UP 142 104 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC 210 123 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
HUANG DASATINIB RESISTANCE DN 69 44 All SZGR 2.0 genes in this pathway
ZHOU PANCREATIC ENDOCRINE PROGENITOR 14 11 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3 41 30 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED 228 119 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A 182 108 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-34/449 225 231 1A hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC