Gene Page:DLX2

Summary?
GeneID 1746
Symbol DLX2
Synonyms TES-1|TES1
Description distal-less homeobox 2
Reference MIM:126255|HGNC:HGNC:2915|Ensembl:ENSG00000115844|HPRD:00527|Vega:OTTHUMG00000132276
Gene type protein-coding
Map location 2q32
Pascal p-value 0.002
Fetal beta 2.219

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003682 chromatin binding IEA -
GO:0003700 transcription factor activity IEA -
GO:0003700 transcription factor activity TAS 1354641
GO:0003727 single-stranded RNA binding IEA -
GO:0005515 protein binding IEA -
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007420 brain development TAS Brain (GO term level: 7) 7590232
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP 85 54 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456 228 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329 219 All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP 176 123 All SZGR 2.0 genes in this pathway
NAGASHIMA EGF SIGNALING UP 58 40 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP 164 122 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION 149 101 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A 100 63 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A 65 44 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION UP 30 22 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240 152 All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D5 39 26 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP 156 101 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312 203 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 1 33 24 All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245 148 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317 208 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS UP 48 31 All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP 223 132 All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO SERM OR FULVESTRANT UP 24 14 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
WANG MLL TARGETS 289 188 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 654 660 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-129-5p 715 721 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-21 951 957 1A hsa-miR-21brain UAGCUUAUCAGACUGAUGUUGA
hsa-miR-590 GAGCUUAUUCAUAAAAGUGCAG
miR-216 1072 1078 1A hsa-miR-216 UAAUCUCAGCUGGCAACUGUG
miR-299-5p 861 867 m8 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
miR-381 827 833 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-450 715 721 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA