Gene Page:DPYSL3

Summary?
GeneID 1809
Symbol DPYSL3
Synonyms CRMP-4|CRMP4|DRP-3|DRP3|LCRMP|ULIP|ULIP-1
Description dihydropyrimidinase like 3
Reference MIM:601168|HGNC:HGNC:3015|Ensembl:ENSG00000113657|HPRD:03104|Vega:OTTHUMG00000163437
Gene type protein-coding
Map location 5q32
Pascal p-value 0.36
Sherlock p-value 0.118
Fetal beta 2.52
Support STRUCTURAL PLASTICITY
CompositeSet
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0032
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01718
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00459
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
NRXN3 0.92 0.92
CNNM1 0.89 0.89
KALRN 0.89 0.85
HRH2 0.89 0.86
MEF2D 0.88 0.88
IQSEC1 0.88 0.91
SMAP2 0.88 0.86
NLK 0.87 0.87
KIAA1045 0.87 0.86
DUSP3 0.87 0.86
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HEBP2 -0.42 -0.50
BCL7C -0.38 -0.45
DBI -0.38 -0.39
AL139819.3 -0.38 -0.41
AF347015.21 -0.36 -0.30
RHOC -0.36 -0.38
RPL35 -0.36 -0.38
RPL31 -0.36 -0.33
RPL34 -0.35 -0.40
C9orf46 -0.35 -0.34

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004157 dihydropyrimidinase activity TAS 8973361
GO:0016810 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9115293
GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process TAS 8973361
GO:0007165 signal transduction TAS 9115293
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0042995 cell projection IEA axon (GO term level: 4) -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME DEVELOPMENTAL BIOLOGY 396 292 All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE 251 188 All SZGR 2.0 genes in this pathway
REACTOME CRMPS IN SEMA3A SIGNALING 14 14 All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS 68 53 All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP 205 140 All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN 481 290 All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP 351 230 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS UP 290 177 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN 199 124 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP 536 340 All SZGR 2.0 genes in this pathway
MCBRYAN发育期乳房4 5周 271 175 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 137 97 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197 135 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP 169 127 All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE 123 80 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP 358 245 All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN 97 51 All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION 149 101 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS 179 105 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP 256 159 All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN 185 111 All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION UP 140 83 All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN 408 274 All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP 249 170 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280 183 All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH UP 74 56 All SZGR 2.0 genes in this pathway
LEIN PONS MARKERS 89 59 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN 191 123 All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 DN 78 49 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN 342 220 All SZGR 2.0 genes in this pathway
MOOTHA PGC 420 269 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP 442 263 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 6 33 22 All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP 105 75 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
国外RB1增长目标 243 155 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP 121 70 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP 266 142 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway
DURAND STROMA S UP 297 194 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-132/212 3181 3188 1A,m8 hsa-miR-212SZ UAACAGUCUCCAGUCACGGCC
hsa-miR-132brain UAACAGUCUACAGCCAUGGUCG
miR-22 3087 3093 m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU
miR-320 162 168 1A hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGAA
miR-328 2626 2632 m8 hsa-miR-328brain CUGGCCCUCUCUGCCCUUCCGU
miR-329 3012 3018 m8 hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-330 176 182 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-421 3084 3090 1A hsa-miR-421 GGCCUCAUUAAAUGUUUGUUG
miR-485-5p 119 125 1A hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
miR-494 132 138 m8 hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU
miR-505 285 291 m8 hsa-miR-505 GUCAACACUUGCUGGUUUCCUC