Gene Page:DSCAM

Summary?
GeneID 1826
Symbol DSCAM
Synonyms CHD2|CHD2-42|CHD2-52
Description Down syndrome cell adhesion molecule
Reference MIM:602523|HGNC:HGNC:3039|Ensembl:ENSG00000171587|HPRD:03953|Vega:OTTHUMG00000086732
Gene type protein-coding
Map location 21q22.2
Pascal p-value 0.267
Sherlock p-value 0.482
Fetal beta 0.372
eGene Myers' cis & trans
元
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
DNM:Xu_2012 Whole Exome Sequencing analysis 新创的突变4基因被确定by exome sequencing of 795 samples in this study
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
DSCAM chr21 41450663 C T NM_001271534
NM_001389
NR_073202		 .
.
.		 silent
silent
npcRNA		 Schizophrenia DNM:Fromer_2014
DSCAM chr21 41710090 G T NM_001271534
NM_001389
NR_073202		 p.574T>K
p.574T>K
.		 missense
missense
npcRNA		 Schizophrenia DNM:Xu_2012

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs2019147 chr21 42422183 DSCAM 1826 0.02 cis
rs7530588 chr1 98913842 DSCAM 1826 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
COG1 0.86 0.80
MAPRE3 0.84 0.78
WIPI2 0.83 0.75
RANGAP1 0.83 0.79
BAP1 0.82 0.79
ZER1 0.81 0.77
GPI 0.81 0.78
PGBD5 0.81 0.79
ENTPD6 0.81 0.81
CACNB1 0.80 0.77
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.59 -0.34
AF347015.18 -0.56 -0.34
IL32 -0.53 -0.41
GNG11 -0.51 -0.40
NOSTRIN -0.49 -0.30
AF347015.8 -0.49 -0.27
MT-CO2 -0.48 -0.27
MT-ATP8 -0.48 -0.29
AP002478.3 -0.47 -0.35
AF347015.2 -0.47 -0.22

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development TAS neurite (GO term level: 5) 9426258
GO:0007155 cell adhesion TAS 9426258
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0005624 membrane fraction TAS 9426258
GO:0005886 plasma membrane TAS 9426258
GO:0005887 integral to plasma membrane TAS 9426258

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID ERA GENOMIC PATHWAY 65 37 All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY 44 29 All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION 120 77 All SZGR 2.0 genes in this pathway
REACTOME DSCAM INTERACTIONS 11 10 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN 139 76 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544 308 All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN 781 465 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357 212 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN 142 94 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528 324 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
JEPSEN SMRT TARGETS 33 23 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO 38 24 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN 195 135 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258 160 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP 324 193 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898 516 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 403 240 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-140 139 146 1A,m8 hsa-miR-140brain AGUGGUUUUACCCUAUGGUAG
miR-182 100 107 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-30-3p 135 141 m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-378* 226 232 m8 hsa-miR-422b CUGGACUUGGAGUCAGAAGGCC
hsa-miR-422a CUGGACUUAGGGUCAGAAGGCC
miR-96 101 107 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC