Gene Page:DTX1

Summary?
GeneID 1840
Symbol DTX1
Synonyms hDx-1
Description deltex 1
Reference MIM:602582|HGNC:HGNC:3060|Ensembl:ENSG00000135144|HPRD:03991|Vega:OTTHUMG00000169610
Gene type protein-coding
Map location 12q24.13
Pascal p-value 0.342
TADA p-value 0.015
Fetal beta 0.233
DMG 1 (# studies)
eGene Myers' cis & trans
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
DNM:Gulsuner_2013 Whole Exome Sequencing analysis 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents.
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
DTX1 chr12 113496202 C G NM_004416 p.69L>V missense Schizophrenia DNM:Gulsuner_2013

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg11787160 12 113515332 DTX1 3.321E-4 0.488 0.041 DMG:Wockner_2014
cg18567954 12 113496168 DTX1 3.708E-4 0.499 0.043 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4467164 chr18 75123435 DTX1 1840 0.2 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception凌晨ks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
THRA 0.70 0.78
ANKDD1A 0.70 0.74
GDF9 0.69 0.66
AC100793.2 0.69 0.69
CHRNB4 0.69 0.70
CUL7 0.69 0.72
ZNF446 0.68 0.74
ZNF185 0.68 0.71
PLSCR3 0.68 0.69
GTF2H4 0.68 0.71
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.27 -0.52 -0.66
MT-CO2 -0.50 -0.65
S100B -0.50 -0.63
AF347015.33 -0.49 -0.64
C5orf53 -0.49 -0.58
AF347015.31 -0.49 -0.63
AF347015.8 -0.49 -0.65
CA4 -0.48 -0.58
CD8BP -0.48 -0.67
MT-CYB -0.47 -0.62

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003713 transcription coactivator activity TAS 9590294
GO:0005112 Notch binding IDA 11564735
GO:0005515 protein binding 新闻学会 7671825
GO:0008270 zinc ion binding IEA -
GO:0017124 SH3 domain binding IEA -
GO:0030528 transcription regulator activity NAS 11564735
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0045665 negative regulation of neuron differentiation IGI neuron (GO term level: 10) 11564735
GO:0010001 glial cell differentiation IEA Glial (GO term level: 8) -
GO:0006366 transcription from RNA polymerase II promoter TAS 9590294
GO:0008593 regulation of Notch signaling pathway IGI 11564735
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm TAS 9590294

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG NOTCH SIGNALING PATHWAY 47 35 All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY 59 49 All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY 46 39 All SZGR 2.0 genes in this pathway
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS 27 18 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1 70 46 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH 103 64 All SZGR 2.0 genes in this pathway
MORI PRE BI LYMPHOCYTE DN 77 49 All SZGR 2.0 genes in this pathway
MORI LARGE PRE BII LYMPHOCYTE DN 58 39 All SZGR 2.0 genes in this pathway
MORI IMMATURE B LYMPHOCYTE UP 53 35 All SZGR 2.0 genes in this pathway
MORI PLASMA CELL DN 33 20 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366 238 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD2 UP 45 32 All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP 104 57 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP 89 62 All SZGR 2.0 genes in this pathway
VILIMAS NOTCH1 TARGETS UP 52 41 All SZGR 2.0 genes in this pathway
MARSHALL VIRAL INFECTION RESPONSE DN 29 21 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN 116 83 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 1052 1058 m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-138 957 963 m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-204/211 1010 1016 m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU