Gene Page:DVL2

Summary?
GeneID 1856
Symbol DVL2
Synonyms -
Description dishevelled segment polarity protein 2
Reference MIM:602151|HGNC:HGNC:3086|Ensembl:ENSG00000004975|HPRD:03690|Vega:OTTHUMG00000102155
Gene type protein-coding
Map location 17p13.1
Pascal p-value 1.528E-4
Sherlock p-value 0.274
Fetal beta 0.361
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.1522

Section I. Genetics and epigenetics annotation

@不同甲基化基因

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg13248847 17 7137857 DVL2 3.88E-5 -0.212 0.02 DMG:Wockner_2014
cg11181795 17 7219971 DVL2 3.03E-4 -4.25 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004871 signal transducer activity TAS 8887313
GO:0042802 identical protein binding 新闻学会 16189514
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0001843 neural tube closure IEA -
GO:0016055 Wnt receptor signaling pathway IEA -
GO:0007379 segment specification IEA -
GO:0007242 intracellular signaling cascade IEA -
GO:0007507 heart development IEA -
GO:0007447 imaginal disc pattern formation TAS 8887313
GO:0007275 multicellular organismal development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm TAS 9192851

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AP1M1 AP47 | CLAPM2 | CLTNM | MU-1A adaptor-related protein complex 1, mu 1 subunit Two-hybrid BioGRID 16189514
AP2M1 AP50 | CLAPM1 | mu2 adaptor-related protein complex 2, mu 1 subunit Two-hybrid BioGRID 16189514
ARR3 ARRX arrestin 3, retinal (X-arrestin) Two-hybrid BioGRID 16189514
ARRB1 ARB1 | ARR1 arrestin, beta 1 - HPRD,BioGRID 11742073
AXIN1 AXIN | MGC52315 axin 1 - HPRD,BioGRID 10829020
BAG3 BAG-3 | BIS | CAIR-1 | MGC104307 BCL2-associated athanogene 3 Two-hybrid BioGRID 16189514
BAHD1 KIAA0945 bromo adjacent homology domain containing 1 Two-hybrid BioGRID 16189514
C16orf48 DAKV6410 | DKFZp434A1319 chromosome 16 open reading frame 48 Two-hybrid BioGRID 16189514
C9orf100 FLJ14642 | MGC44886 | RP11-331F9.7 chromosome 9 open reading frame 100 Two-hybrid BioGRID 16189514
CCDC33 FLJ23168 | FLJ32855 | MGC34145 coiled-coil domain containing 33 Two-hybrid BioGRID 16189514
CSNK1E HCKIE | MGC10398 casein kinase 1, epsilon Two-hybrid BioGRID 16189514
CSNK2A1 CK2A1 | CKII casein kinase 2, alpha 1 polypeptide Affinity Capture-Western BioGRID 10806215
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa Affinity Capture-Western BioGRID 10806215
DAB2 DOC-2 | DOC2 | FLJ26626 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) Affinity Capture-Western
Reconstituted Complex		 BioGRID 12805222
DDI1 FLJ36017 DDI1, dna损伤诱导1,同族体1 (S. cerevisiae) Two-hybrid BioGRID 16189514
DPPA2 PESCRG1 developmental pluripotency associated 2 Two-hybrid BioGRID 16189514
DVL2 - dishevelled, dsh homolog 2 (Drosophila) Affinity Capture-Western
Two-hybrid		 BioGRID 16189514
FAM105B FLJ34884 family with sequence similarity 105, member B Two-hybrid BioGRID 16189514
FLJ12529 FLJ39024 | MGC9315 pre-mRNA cleavage factor I, 59 kDa subunit Two-hybrid BioGRID 16189514
MAP3K1 MAPKKK1 | MEKK | MEKK1 mitogen-activated protein kinase kinase kinase 1 Affinity Capture-Western BioGRID 10829020
MCRS1 ICP22BP | INO80Q | MCRS2 | MSP58 | P78 microspherule protein 1 Two-hybrid BioGRID 16189514
PCBD1 DCOH | PCBD | PCD | PHS pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Two-hybrid BioGRID 16189514
POLI RAD30B | RAD3OB polymerase (DNA directed) iota Two-hybrid BioGRID 16189514
PRPF3 HPRP3 | HPRP3P | PRP3 | Prp3p | RP18 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) Two-hybrid BioGRID 16189514
RBPMS HERMES RNA binding protein with multiple splicing Two-hybrid BioGRID 16189514
RHOXF2 PEPP-2 | PEPP2 | THG1 Rhox homeobox family, member 2 Two-hybrid BioGRID 16189514
RNPS1 E5.1 | MGC117332 RNA binding protein S1, serine-rich domain Two-hybrid BioGRID 16189514
SNF8 Dot3 | EAP30 | VPS22 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Two-hybrid BioGRID 16189514
SNIP1 FLJ12553 | RP3-423B22.3 | dJ423B22.2 Smad nuclear interacting protein 1 Two-hybrid BioGRID 16189514
SORBS3 SCAM-1 | SCAM1 | SH3D4 | VINEXIN sorbin and SH3 domain containing 3 Two-hybrid BioGRID 16189514
TCEB3B ELOA2 | HsT832 | MGC119351 | TCEB3L transcription elongation factor B polypeptide 3B (elongin A2) Two-hybrid BioGRID 16189514
THAP1 FLJ10477 | MGC33014 THAP domain containing, apoptosis associated protein 1 Two-hybrid BioGRID 16189514
TIFA MGC20791 | T2BP | T6BP | TIFAA TRAF-interacting protein with forkhead-associated domain Two-hybrid BioGRID 16189514
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 Two-hybrid BioGRID 16189514
TRAF2 MGC:45012 | TRAP | TRAP3 TNF receptor-associated factor 2 Two-hybrid BioGRID 16189514
U2AF2 U2AF65 U2 small nuclear RNA auxiliary factor 2 Two-hybrid BioGRID 16189514
USP5 ISOT ubiquitin specific peptidase 5 (isopeptidase T) Two-hybrid BioGRID 16189514
VANGL1 LPP2 | MGC5338 | STB2 | STBM2 vang-like 1 (van gogh, Drosophila) - HPRD 15456783
ZBTB8 BOZF1 | FLJ90065 | MGC17919 zinc finger and BTB domain containing 8 Two-hybrid BioGRID 16189514
ZNF165 LD65 | ZSCAN7 zinc finger protein 165 Affinity Capture-Western
Two-hybrid		 BioGRID 16189514
ZNF250 FLJ57354 | MGC111123 | MGC9718 | ZFP647 | ZNF647 zinc finger protein 250 Two-hybrid BioGRID 16189514
ZNF263 FPM315 | ZKSCAN12 zinc finger protein 263 Two-hybrid BioGRID 16189514


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG NOTCH SIGNALING PATHWAY 47 35 All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS 102 80 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA 55 44 All SZGR 2.0 genes in this pathway
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY 32 26 All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY 18 17 All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY 20 18 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY HIPPO 22 15 All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663 425 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN 36 24 All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 1 13 11 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR 37 22 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307 185 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 126 133 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-138 138 145 1A,m8 hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-27 127 133 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-495 460 466 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU