Gene Page:PHC1
Summary?
GeneID | 1911 |
Symbol | PHC1 |
Synonyms | EDR1|HPH1|MCPH11|RAE28 |
Description | polyhomeotic homolog 1 |
Reference | MIM:602978|HGNC:HGNC:3182|Ensembl:ENSG00000111752|HPRD:16009|Vega:OTTHUMG00000168275 |
Gene type | protein-coding |
Map location | 12p13 |
Pascal p-value | 0.94 |
Sherlock p-value | 0.657 |
Fetal beta | 1.248 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 |
Support | Chromatin Remodeling Genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Expression | Meta-analysis of gene expression | Pvalue: 1.395 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12581035 | 12 | 9067477 | PHC1 | 2.43E-8 | -0.009 | 7.89E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PHC1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0005515 | protein binding | TAS | 9121482 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | TAS | 9121482 | |
GO:0005730 | nucleolus | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KORKOLA EMBRYONAL CARCINOMA UP | 41 | 27 | All SZGR 2.0 genes in this pathway |
KORKOLA SEMINOMA UP | 44 | 27 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN D6MIT150 QTL CIS | 7 | 6 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY DEACETYLATION IN PANCREATIC CANCER | 50 | 30 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
CONRAD STEM CELL | 39 | 27 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
MIKKELSEN DEDIFFERENTIATED STATE UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
KORKOLA CORRELATED WITH POU5F1 | 34 | 12 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 6 UP | 140 | 81 | All SZGR 2.0 genes in this pathway |
DUAN PRDM5 TARGETS | 79 | 52 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-149 | 1318 | 1324 | m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-24 | 1316 | 1323 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-29 | 162 | 169 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-452 | 996 | 1003 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
miR-493-5p | 937 | 943 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.