Gene Page:ENSA
Summary?
GeneID | 2029 |
Symbol | ENSA |
Synonyms | ARPP-19e |
Description | endosulfine alpha |
Reference | MIM:603061|HGNC:HGNC:3360|Ensembl:ENSG00000143420|HPRD:11927|Vega:OTTHUMG00000035004 |
Gene type | protein-coding |
Map location | 1q21.3 |
DEG p-value | DEG:Zhao_2015:p=3.17e-04:q=0.0924 |
Fetal beta | -1.231 |
eGene | Myers' cis & trans |
Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Expression | Meta-analysis of gene expression | Pvalue: 2.04 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12139286 | chr1 | 150262454 | ENSA | 2029 | 0.15 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/ENSA_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
补充说明:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
补充说明:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MED13 | 0.88 | 0.89 |
LASS6 | 0.88 | 0.93 |
ZNF148 | 0.88 | 0.90 |
SPAST | 0.88 | 0.90 |
BICD1 | 0.88 | 0.90 |
PDS5A | 0.87 | 0.90 |
PPP2R5E | 0.87 | 0.92 |
UBXN2B | 0.87 | 0.93 |
CAPRIN1 | 0.87 | 0.91 |
ZMYM4 | 0.87 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.67 | -0.84 |
AIFM3 | -0.67 | -0.76 |
TSC22D4 | -0.66 | -0.77 |
HEPN1 | -0.66 | -0.75 |
S100B | -0.65 | -0.79 |
AF347015.31 | -0.65 | -0.81 |
AF347015.33 | -0.65 | -0.81 |
MT-CO2 | -0.65 | -0.83 |
HSD17B14 | -0.64 | -0.76 |
AF347015.27 | -0.64 | -0.80 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9653196 |
GO:0008200 | ion channel inhibitor activity | TAS | 9653196 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007584 | response to nutrient | TAS | 9653196 | |
GO:0006810 | transport | TAS | 9653196 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN | 92 | 51 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
ODONNELL METASTASIS DN | 24 | 13 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG助教RGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
YAGI AML RELAPSE PROGNOSIS | 35 | 24 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
NOUZOVA TRETINOIN AND H4 ACETYLATION | 143 | 85 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS UP | 40 | 20 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12 | 79 | 54 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
PURBEY CTBP1的目标SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-143 | 2027 | 2033 | m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
miR-15/16/195/424/497 | 1134 | 1140 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-410 | 1988 | 1994 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-503 | 1134 | 1140 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.